Aktuelle Zeit: Di, 11. Dez 2018 23:19


Forum gesperrt Dieses Thema ist gesperrt. Du kannst keine Beiträge editieren oder weitere Antworten erstellen.  [ 61 Beiträge ]  Gehe zu Seite Vorherige  1, 2, 3, 4  Nächste

Alle Zeiten sind UTC + 1 Stunde [ Sommerzeit ]

Autor Nachricht
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:01 
Brüder und Schwestern

Sir Martin stand auf. Er sah sich um, alles war weiß. Schließlich begutachtete er seinen rechten Arm und freute sich, denn er war wieder ganz. Nichts ließ mehr darauf schließen, dass Misel ihn mit einer Axt abgetrennt hatte. Sie hatte den Unterarm danach auch noch so hinunter geworfen, dass er Sir Martin schmerzhaft am Kopf getroffen hatte, als dieser gerade verstarb. Doch jetzt war alles wieder in Ordnung und da erschien auch schon Gott. Ein schlechtes Gefühl plagte Sir Martin und deshalb sprach er es gleich aus: „Ich habe versagt! Ich konnte das Dokument nicht besorgen, wir müssen uns also etwas anderes einfallen lassen.“ Mit seiner alles ehrfürchtig erstarrenden Stimme antwortete Gott: „Wieso versagt, einen größeren Erfolg hättest du gar nicht fabrizieren können!“ „Willst du mich verarschen?“ „Nein, ich meine es ernst. Das Dokument war zweitrangig, stattdessen hast du etwas beschleunigt, das noch Jahre gedauert hätte.“ „Ich versteh nichts mehr.“ „Du hast die Prophezeiung ausgelöst!“ „Wie? Die beiden werden die Lösung des Konfliktes zwischen den Ersten und den Alten erschaffen?“ „Ganz genau, und nebenbei werden unsere Aktionen einfacher, weil diese Lösung, wie du es ausdrückst, sie und ihre Verbündeten sehr stark ablenken wird!“ „Ah, jetzt begreife ich es.“ „Aus dir wird vielleicht wirklich wieder ein Gott.“ „Was heißt hier vielleicht?“

„Was ist denn mit dir passiert?“ fragte Horny Seisuke, als er in dessen Büro trat. Seisuke hatte ein blaues, blutunterlaufenes Auge und saß gerade über einigen Berichten. Horny schloss die Tür und setzte sich, da antwortete Seisuke: „Das ist eine lange Geschichte.“ „Ich hab Zeit.“ „Na gut, vor ein paar Stunden hat Horizonte hier angerufen und gemeint, dass Sir Martin wieder unter den Lebenden weilt, irgendwie zumindest. Er arbeitet jetzt allerdings gegen uns und zwar für die Ersten.“ „Ja, aber was hat das jetzt mit dem blauen Auge zu tun?“ „Ich komm ja noch dahin. Jedenfalls hatten Misel und er einen Kampf gegen den Sir, gewannen ihn, aber Horizonte wurde wohl etwas verletzt, also hat er Rodamar nach Minas Morgul gerufen.“ „Deswegen wirst du aber nicht dieses blaue Auge haben!“ „Gedulde dich doch mal. Wir haben nämlich jetzt einen Auftrag, wir sollen irgendwas beim PAX in die Luft sprengen. Doch dazu wollte ich alle Informationen über das PAX und die bekommt man beim Außenministerium.“ „Das Misel innehat, aber die ist gar nicht da.“ „Genau, also ich da hin und hab ihre Vertretung aus dem diplomatischen Korps getroffen. Sie heißt Demonhound.“ „Hat sie dir das Veilchen verpasst?“ „Nein. Nachdem sie mir alles geben hatte, was über das PAX aufzutreiben war, verließ ich ihr Büro und traf auf dem Gang Azmodan.“ „General Azmodan?“ „Wen denn sonst. Nun ich teilte ihm mit, dass Demonhound ein attraktives Äußeres hat und ich gerne mal mit ihr etwas unternehmen würde. Da teilte Azmodan mit seiner Faust mir mit, dass Demonhound seine Schwester ist.“ „Du hast die Dinge über Demonhound wohl etwas anders ausgedrückt?“ „Ein kleiner wenig vulgärer.“ „Ein klein wenig?“ „Vielleicht auch etwas mehr. Nachdem er mich geschlagen hatte, wollte ich zu Rodamar, damit er was gegen die Schwellung und den Bluterguss tun kann.“ „Doch der war gerade auf dem Weg nach Minas Morgul.“ „Nachdem ich mitgeschnitten hatte, dass er gar nicht da ist, bin noch zu einem anderen Arzt. Er konnte aber nur noch die Schwellung behandeln, für den Bluterguss soll es zu spät gewesen sein.“ „Dann pass beim nächsten mal besser auf, zu wem du etwas sagts, Seisuke!“ Horny lehnte sich zurück und fragte: „Was ist denn das für ein Auftrag von Horizonte?“ „Wir sollen in einer ihrer größeren Städte eine Sauerstoffraffinerie zerstören.“ „Und wie sollen wir das?“ „Ein Team der Phoenix-Special-Forces deaktiviert den Schutzschild der Stadt. Es ist die einzige ernstzunehmende Defensiveinrichtung in dieser Stadt, da gerade die Flughafen und die anderen Verteidigungsanlagen überholt werden. Sobald der Schild unten ist, wird ein Jagdgeschwader der US-Air Force von der Pegasus starten und die Raffinerie in die Luft jagen.“ „Warum amerikanische Flieger, das ist doch ein europäisches Schiff?“ Seisuke kramte etwas und antwortete dann: „Moment hier steht: ‚Der europäische Raumüberlegenheitsjäger unterliegt im Flug durch eine Atmosphäre seinem enormen Gewicht, welches zum Teil durch den eigenen Schildgenerator verursacht wird, und anderen aerodynamischen Problemen. Im Gegensatz dazu, ist der nur leicht gepanzerte, amerikanische AOF (Air and Orbital Fighter) wesentlich besser für suborbitale Einsätze geeignet. Hier wird er nur durch die Wendigkeit eines Falcons übertroffen.’ Heißt soviel wie: Europäische Raumjäger fliegen sich auf dem Planeten wie Backsteine, sind aber leistungsfähiger im Weltraum. Deshalb hat das Phoenix-Oberkommando befohlen, dass sich auf jedem amerikanischen Trägerschiff mindestens ein europäisches Jagdgeschwader befinden soll und umgekehrt gilt dasselbe für europäische Schiffe.“ „OK, dann sollte es ja keine Probleme geben, sag einfach der PSF und den Piloten was zu tun ist und schon sind wir fertig.“ „So leicht ist es allerdings nicht.“ „Wieso?“ „Nun, Horizonte meinte, dass wir unbedingt mal miterleben sollten, wie so ein Einsatz abläuft und zwar hautnah.“ „Wir sollen da mit fliegen?“ fragte Horny geschockt und Seisuke wusste, dass die Wahrheit ihm noch weniger gefallen würde: „Nein, wir sollen den Schild mit ausschalten.“ „Geht man dabei nicht leicht drauf?“ „Er meinte, dass die Prätorianer vom PSF-3 uns schon heil nach hause bringen würden.“ „Deswegen haben die mich vorhin so angegrinst. Wusstest du eigentlich, dass die einen neuen Truppführer haben?“ „Die haben ihren alten doch in den Ruinen verloren.“ „Genau, der neue heißt Master Nitro und ist der Bruder von General Marco.“ „Die Hadals sind ein richtiger Familienclan geworden.“ Scherzte Seisuke.


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:02 
In dem Moment klopfte es an die Tür. Seisuke rief: „Herein.“ Es trat ein Mann ein, er schloss die Tür und sagte: „Hi, ich suche meine Schwester, sie sollte eigentlich hier irgendwo sein.“ „Wie heißt sie denn?“ fragte Seisuke. „Misel, manchmal auch Daente, kommt auf ihre Stimmung an.“ „Du bist der Bruder von Misel?“ äußerte Horny verblüfft und Seisuke antwortete: „Sie hat mir mal erzählt, dass sie einen hat, aber sie sagte mir, dass ich lieber nicht fragen soll, wie er denn heißt. Also wie heißt du denn eigentlich?“ „Purpur Tentacle!“ „Na gut, jetzt weis ich, dass ich lieber nicht gefragt hätte.“ „Hey, das ist ein ehrenhafter Name, den schon viele in meiner Familie besaßen.“ „Das macht ihn nicht wirklich besser.“ Spottete Horny. Purpur wurde ungeduldig und war die Witze auf seine Kosten leid: „Wo ist denn nun meine Schwester?“ Seisuke antwortete auf die Frage: „Sie ist noch eine Woche in Minas Morgul, du bleibst also besser hier und wartest auf sie.“ „Verdammt, da reist man anderthalb Jahre mit Überlichtgeschwindigkeit und verpasst dann die eigen Schwester um eine Woche. Arbeitete sie dort für das Phoenix-Programm?“ „Woher weist du denn davon?“ „In ihrer Wohnung in lag ein Buch mit dem Titel: ‚Das Phoenix-Programm – Hintergründe, Aufbau und Prognosen.“ Horny sah ihn an und sagte: „Das ist doch der 3000 Seiten Wälzer, den Horizonte uns allen gegeben hat. Den hast du gelesen? Ich bin nicht mal über die Einleitung ‚Die Legende vom Phoenix – historische und mythologische Grundlage zur Rettung der Erde’ hinaus gekommen.“ „Nein ich habe es nicht gelesen, ich habe aufgeschlagen und gleich erkannt, dass meine Schwester es garantiert nicht gelesen hat. Daneben lag auch gleich ein kleineres Buch: ‚Das Phoenix-Programm – eine kleine Zusammenfassung’. Aber auch das hatte noch immer 500 Seiten, also suchte ich weiter und fand die BBC-Dokumentation, die im Falle eines Erfolges, dem Rest der Menschheit gezeigt würde. Und die 3 Stunden hab ich mir dann gelangweilt angesehen.“ Seisuke lehnte sich nach vorne und sagte: „Wo bekommt man das Video her? Ich bin beim Originalbuch jetzt bei Kapitel 2: ‚Grundlagen der Berechnung und der statistischen Erfassung statischer und dynamischer Prozesse während der Ozonbildung in der oberen Atmosphäre mittelgroßer Planeten, im Vergleich zwischen der Erde und Erde2’.“ Horny sah Seisuke etwas irritiert an, wies dann aber Seisuke auf die eigentliche Aufgabe hin: „Wir sollten uns nun wirklich die Planung für den Angriff machen.“ Seisuke stimmte zu: „Das sollten wir, Moment, Purpur willst du vielleicht mitmachen?“ „Wieso nicht, um was geht es denn?“

„Sie halten sich immer dicht hinter mir! Verstanden?“ brüllte Nitro Purpur, Horny und Seisuke an. Alle drei nickten, was hätten sie auch sonst tun sollen? Überall rappelte und polterte es, denn der gerade mit voller Fahrt fahrende Lastwagen, in dessen Anhänger man sich befand, besaß nur ein altes Hover-Triebwerk, welches seine besten Tage längst hinter sich hatte. Die anderen drei Mitglieder des PSF-3 saßen ihnen gegenüber und kontrollierten ihre Ausrüstung, Nitro stand und hielt sich an einer Haltestange fest. Seisuke fragte Nitro: „Wie kommen wir eigentlich in die Stadt rein?“ Nitro setzte sich neben Seisuke und antwortete: „Wir haben Agenten in das PAX eingeschleust. Zwei von ihnen, Geschwister, wollen abgelöst werden und dies hier ist die beste Möglichkeit. Sie arbeiten in der Sauerstoffraffinerierungskontrolle und haben einige neue Gerätschaften angefordert und wir liefern die jetzt aus.“ „Die bringen uns rein und wir nehmen sie mit raus.“ „Genauso und wenn wir draußen sind, dann gibt es das größte Feuerwerk, das der Planet je gesehen hat!“

Der Lastwagen hatte mehrmals angehalten und dann wieder fahrt aufgenommen. Schließlich kam er endgültig zum Stehen und nach einigen Minuten knackte es und die Tür des Anhängers ging auf. Eine Frau öffnete sie und sah dann direkt in die Mündungen von drei Plasma-Gewehren. Sie sagte: „Ich bin es doch nur, Nikitaman. Die Luft ist rein, also kommt, wir müssen uns beeilen bevor man uns noch entdeckt!“ Alle stiegen aus und Nikitaman schloss danach die Tür wieder.

Auf dem Weg in ein großes, graues Gebäude fragte Nitro Nikitaman: „Ist die Sprengladung am Schildgenerator angebracht?“ „Future erledigt das gerade.“ „Und was ist mit den Notfallsystemen?“ „Da gibt es ein Problem. Der Ersatzgenerator befindet sich in einem gesperrten Teil unter der Raffinerie. Seit einem Jahr kommt dort keiner ohne die höchste Sicherheitsstufe hinein.“ „Können wir uns durchkämpfen?“ Sie betraten das leere Gebäude, als Nikitaman antwortete: „Ich glaube kaum, die haben dort überall Wachen, es gibt aber einen alten Versorgungsschacht, durch den könnten wir zum Generator kommen und ungesehen wieder verschwinden.“ „Gut, dann sollten wir erst mal Future treffen.“ „Der Treffpunkt ist im Hauptkontrollraum.“

Einige Minuten und mehrere hundert Meter in grauen Gängen später, betrat man den Hauptkontrollraum. Er war groß, grau und absolut Menschenleer. An einer wand standen einige Pulte mit einer Menge leuchtender Knöpfe und darüber waren Bildschirme angebracht, die gerade die Abläufe der automatisierten Raffinerie überwachten. Nitro sah sich etwas um und fragte dann Nikitaman: „Warum ist hier keiner?“ „Kostenreduzierung, es reichen zwei Menschen aus, um diese Raffinerie zu überwachen und Future hat es so gedreht, dass wir beide heute die Aufgabe übernehmen konnten.“ An der den Pulten und Bildschirmen gegenüberliegenden Wand gab es ein großes Fenster. Dahinter konnte man die riesigen Sauerstofftanks und die Wasserleitungen erkennen. Es war ein unförmiges, kompliziertes Gewirr von grauen Stahlleitungen, Türmen und anderen Gebäuden und so weit man blicken konnte, waren weder Anfang und noch Ende zu sehen. Nitro wandte seinen Blick von dem Fenster ab und fragte Nikitaman: „Warum sieht das hier so trostlos aus?“ „Das ist eine vollkommen automatische arbeitende Raffinerie, außer uns ist niemand da, dem die Aussicht missfallen könnte.“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:03 
Nikitaman hatte ihre letzten Worte kaum beendet, da öffnete sich eine Tür und Future betrat den Raum. Aus einem Reflex heraus zielte Nitro mit seinem Gewehr auf ihn. Er senkte die Waffe wieder, als er ihn erkannte. Future kam etwas näher und meldete: „Die Bombe ist platziert, jetzt müssen wir uns nur noch den Ersatzgenerator kümmern.“ „Gut, ich werde die Pegasus anweisen, ihre Jäger zu starten.“ Entgegnete Nitro.

„Verstanden, das Geschwader wird umgehend starten, Pegasus Ende.“ Der Kommunikationsoffizier wechselte auf den internen Kanal: „Colonel Peters, sie haben Starterlaubnis, ich wiederhole: Starterlaubnis für Staffel Alpha!“

Der Colonel saß bereits in seinem Cockpit und antwortete dem Kommunikationsoffizier: „Habe verstanden, Start in einer Minute.“ „Viel Glück und kommen sie alle heil wieder zurück.“ „Danke, Pegasus, wäre doch zuschade den Hackbraten heute Abend zu verpassen.“ Er wechselte auf den Staffelkanal und sagte: „So Mädels, wir gehen tief rein, werfen unsere Ladung ab und gehen hoch wieder raus. Danach drehen wir noch ein paar Runden im All, auf diesen ‚Kautschukbraten’ heute Abend kann ich echt verzichten. Dabei machen die Europäer ständig Witze über unser Essen!“ Ein Gelächter aus den Lautsprechern teilte ihm die Zustimmung der anderen Piloten mit, dann setzte er fort: „So nun wollen wir aber los, Start in 3, 2, 1.“ Die Staffel erhob sich um etwa einen Meter in die Luft und flog dann aus dem Hangar hinaus in den tiefschwarzen Weltraum.

„Es ist verdammt dreckig hier!“ meckerte Seisuke unablässig, als die Gruppe den Lüftungsschacht zum Ersatzgenerator hinabkletterte. Er brachte Nikitaman an den Rand des Wahnsinns: „Hör endlich auf, dich zu beschweren, sei froh, dass der Schacht eine Wartungstreppe hat und wir uns nicht abseilen müssen.“ Nitro unterbrach sie: „Seid still, so laut wie ihr schreit, hört euch das ganze PAX!“ „Aber er hat doch angefangen.“ Meckerte diesmal Nikitaman und Seisuke entgegnete: „Ich hab doch nur die Wahrheit gesagt.“ „Ruhe jetzt, beide. Niemand spricht mehr, wenn es nicht unbedingt sein muss.“ Beendete Nitro den Streit.

Future war voraus gegangen und stand nun an einer Luke, die er vorsichtig öffnete. Darunter befand sich niemand und so stiegen die drei Prätorianer, gefolgt von Nitro leise in den Generatorraum hinab. Sie halfen dann den anderen dabei möglichst geräuschlos auf den Boden zu kommen. Doch Horny rutschte ab und knallte auf den Boden ungestützt auf. Es erklang bei seinem Aufprall ein lauter, dumpfer Ton und ohne eine merkbare Reaktionszeit drehten sich die Nitro und die Prätorianer zu der einzigen Tür in diesem Raum. Sie gingen auf sie zu, bis sie sich öffnete. Nitro sprang an eine der Türseiten, ergriff die hereinkommende Wache und brach ihr im selben Moment das Genick. Zwei Prätorianer standen direkt vor der geöffneten Tür und im selben Moment, wie Nitro die Wache ausschaltete, feuerten sie mehrere Salven in den Gang, in dem sich mehrere andere Wachen befanden und warfen dann eine Granate. Mit dem Wurf der Granate stellten sie auch das Feuer ein und der dritte Prätorianer schloss danach die Tür und verriegelte sie gerade, als das Geräusch der Explosion zu hören war. Horny stand wie die anderen stöckelsteif da und brachte nichts weiter heraus als: „Tut mir leid!“ Seisuke trat zu ihm und sagte: „Ach was denn, ist doch nichts passiert!“ Nitro legte die Leiche weg und sagte: „Das waren keine Menschen, das erkenne sogar ich an der rostfarbenen, schuppigen Haut und an dem wulstigen Gesicht, sieht richtig gemein aus. Wenn es Außerirdische sind, dann kenne ich ihre Spezies nicht.“ „Du kannst die ja mal fragen, wer sie eigentlich sind!“ meldete Purpur ganz beiläufig und sah aus einem Fenster. Die anderen traten dann ebenfalls an das Fenster und erkannten, wen Purpur meinte.

Hinter dem Fenster erstreckte sich eine riesige ausgeleuchtete Höhle, deren Boden bedeckt war mit Angehörigen jener Wachen. Sie trainierten offenbar Kampftechniken und an den Höhlenwänden befanden sich Panzer, Flugzeuge und anderes Gerät.


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:03 
„Das müssen ja hunderttausende sein!“ sprach es Horny aus. Future berichtigte ihn: „Ich würde eher von einer oder zwei Millionen ausgehen!“ „Daneben noch einige Zehntausend Panzer, Destroyer und Ravanger.“ Ergänzte Nitro, ging zurück zu der Leiche, hob seine Waffe auf und setzte fort: „Und wenn ich mir dieses Gewehr ansehe, dann hat das PAX den Bre’ouri einen Großauftrag erteilt.“ „Bre’ouri?“ fragte Seisuke und Nitro antworte darauf: „Vor zwei Jahren hatten wir Kontakt zu einer außerirdischen Rasse, den Bre’ouri, sie waren Waffenhändler. Der Phoenix kaufte ein paar dieser Gewehre und unsere Wissenschaftler analysierten sie. Soweit ich weis, soll der erste Prototyp nächstes Jahr in Serie gehen.“ „Was ist denn so toll an diesen Waffen?“ fragte Nikitaman. „Es sind fast reine Energiewaffen, sie arbeiten mit einer Subraumphasenverschiebung, deshalb nennen wir sie Phasengewehre.“ „Wie in Star Trek?“ „Nicht ganz, aber sie sehen im Einsatz so aus. Die Bre’ouri-Waffen kann man in der Stärke so einstellen, dass sie auch betäuben können und man kann sich zwischen einer Puls- oder Strahleinstellung entscheiden.“ „Das ist ja ganz schön, wir sollten aber nicht vergessen, was wir hier vorhaben!“ belehrte Future Nitro und dieser erwiderte: „Richtig, wir können aber keinen Sprengsatz riskieren.“ „Warum nicht?“ „Weil die mit den Waffen, in null Komma nichts durch diese Tür sind und den Sprengsatz entschärfen könnten. Wir brauchen etwas Subtileres.“ Nikitaman sagte daraufhin: „Das ist ein alter Typ-1 Generator, wir brauchen bloß den Energie-Grenzwert für die Schildaktivierung zu erhöhen.“ Seisuke wunderte sich und teilte das auch poetisch mit: „Hä?“ Nikitaman erklärte: „Der Schild braucht eine gewisse Aktivierungsenergie, damit er sich aufbaut, die muss erst mal vorhanden sein und solange sammelt der Generator ständig Energie. Bei diesen alten Generatoren gibt es das Problem, dass sie nicht bei einer gewissen Menge Energie abschalten, sie nehmen einfach so viel auf, bis sie explodieren.“ „Gut jetzt versteh ich’s, du willst ihn überladen.“ Bestätigte Seisuke und Nitro befahl: „Mach das so, die anderen, sofort wieder in den Lüftungsschacht. Future, was war hier mal in dieser Höhle?“ „Eine unterirdische Sauerstoffraffinerie.“ „Dann müssen noch Leitungen zu den Sauerstofftanks an der Oberfläche bestehen, die wir öffnen können.“ „Ja, jedoch nur, wenn man sie nicht versiegelt hat. Aber warum willst du das?“ „Wir fluten diese Höhle mit Sauerstoff und wenn die Raffinerie oben zerstört wird, dann wird diese Armee hier gleich mit gebraten.“ „Ist das nicht ein wenig brutal, wir wissen doch gar nicht, was das PAX mit denen vorhat.“ „Ich will gar nicht wissen, was das PAX mit einer derart überwältigenden Armee plant.“ Bis auf Nitro und Nikitaman waren alle bereits dabei, den Schacht wieder nach oben zu klettern. „Bist du bald fertig?“ fragte Nitro. Nikitaman ignorierte ihn und stellte weiter den Generator ein, bis sie zufrieden sagte: „Fertig, wenn wir den Hauptgenerator zerstören, wird der Ersatzgenerator aktiviert und dann explodieren.“ „Gut und jetzt rauf mit dir!“

Der Schacht war fast hundert Meter lang und so brauchten alle ein paar Minuten für die Kletterpartie, als nur noch Nitro im Schacht war, öffnete sich die Luke zum Generatorraum und ein paar der Wachen kletterten in Windeseile zu ihm hoch. Er nahm eine sein Gewehr und schoss in ihre Richtung, wer von ihnen nicht getroffen wurde, wurde von den Toten über ihnen mit nach unten gerissen. Schließlich schaffte es Nitro in den Hauptkontrollraum, eine der Wachen hatte sich aus dem Knäuel von Leichen am Boden befreit und hatte den Weg bis nach oben bereits geschafft, als Nitro eine Granate in den Schacht warf und die Luke verschloss. Er hörte noch die Explosion der Granate, als einer der Prätorianer ihn ansprach: „Wir haben alle Ausgänge gecheckt. Überall sind Kerle von derselben Sorte wie unten.“ „Dann sitzen wir hier fest.“ Kombinierte Nitro.

„Hier ist Alpha Leader. Nach meinen Anzeigen sind sie noch immer im Zielgebiet.“ Fragte Colonel Peters Nitro und jener antwortete: „Wir sind hier sicher, weiter wie geplant.“ „Verstanden.“

„Stimmt doch, dass wir hier sicher sind.“ Fragte Nitro und Nikitaman antwortete: „Ich glaube schon, dieser Raum soll einen direkten Beschuss standhalten, aber sicher bin ich mir nicht.“ Future drehte sich von seinem Pult weg und meldete: „Die Höhle ist geflutet.“ „Auch die Gänge hier draußen?“ fragte Nitro nach. „Die ebenfalls.“ „So dann werde ich mal den Generator in die Luft jagen.“ „Woran merken wir, dass es funktioniert hat?“ fragte Purpur. „An der Explosion des Ersatzgenerators unter uns und auf jeden Fall an der Explosion da draußen.“ Nitro zeigte dabei auf das Fenster und drückte dann auf den Knopf des Fernzünders. Nichts war zu hören, bis nach etwa einer Minute ein starkes Grummeln zu hören war und der Boden leicht vibrierte. „Das war der Ersatzgenerator, der Angriff muss jeden Moment erfolgen.“ Sagte Nitro und ein Prätorianer schrie darauf hin: „Jeder hinlegen, von dem Fenster abwenden, die Augen schließen und auf keinen Fall in das Licht sehen. Der Sauerstoff wird Explosion der Raketen auf extreme Temperaturen bringen, sodass sie erblinden würden, wenn sie in die Explosion sehen!“ Alle legten sich hin und sie brauchten nicht lange zu warten, dann hörten, spürten und sahen die Explosion. Das Licht war so stark, das es durch die Augenleider fuhr, als wenn man direkt mit geschlossen Augen in die Sonne sehen würde, dabei waren das nur die Reflexionen am Boden unter ihnen. Von der Gruppe unbemerkt drang das Feuer über die geöffneten Leitungen auch in die Höhle und in die Gänge vor dem Hauptkontrollraum ein. Überall wo etwas Sauerstoff war, hinterließ er nur verbrannte Leichen und Asche, da wo sich viel Sauerstoff befunden hatte, war nichts mehr von den wachen übrig geblieben.

Das Donnern der Explosion hallte längst nicht mehr in dem Hauptkontrollraum und das grelle weiße Licht der Explosion war einem warmem Rot-Ton gewichen. Der verarbeitete Stahl und andere Metalle hatten einen großen Teil der Wärme aufgenommen und sandten nun gelbe bis rötliche Strahlen aus, als wollten sie alle warnen, ihnen nicht zu nah zu kommen.

„Wir sollten jetzt los.“ Schlug Nitro vor, doch Future ging zu einem kleinen Schrank und nahm einige Atemmasken heraus. Er erklärte: „Vielleicht habt ihr den Geruch bereits bemerkt, es riecht wie im Hallenbad, aber es ist kein Chlor, sondern Ozon, das sich bei der Explosion aus dem Sauerstoff gebildet hat. Diese Schutzmasken filtern das Ozon raus, wenn ihr sie nicht tragt, fallen euch im besten Fall in zwanzig Jahren die Haare aus!“ Ohne zu protestieren setzten alle die Atemmasken auf und dann öffnete Nitro die Tür. „Ganz schon heiß da draußen!“ meinte Seisuke, doch niemand nahm so richtig davon Notiz. Man versuchte zu einem Fahrzeug zu gelangen und aus der Stadt zu entkommen, doch es war schon schwer genug, ohne sich übergeben zu müssen, durch die knöchelhohe Asche zu waten. Das waren die Überreste der Wachen in den Gängen. Nach einigen Minuten fanden sie den Lastwagen beinahe unversehrt vor, die Garage, in der er geparkt gewesen war, hatte das Gröbste von ihm abgehalten. Der Fahrer startete den Motor und alle waren froh da heil raus gekommen zu sein.

Wieder polterte der Lastwagen über die Straße, da fragte Seisuke Nitro: „Was meinst du waren das für Soldaten?“ Nitro saß ihm gegenüber, blickte ihn an und antwortete: „Keine Ahnung, aber ich habe das Gefühl, dass wir das noch früh genug rausbekommen.“ Dabei holte er etwas aus seiner Jackentasche, es war ein Finger von der Wache, die er getötet hatte. Seisuke hielt es nicht mehr aus und übergab sich. Purpur fragte: „Nitro, wann hast du den denn abgeschnitten und warum?“ „Als jeder von euch aus dem Fenster die anderen Soldaten beobachtet hat und wie sonst sollen wir raus finden wer die sind? Wenn wir ihnen das nächste Mal begegnen, müssen wir vorbereitet sein!“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:05 
Schöne Bescherung

Ein Arbeiter wies den Bohrroboter die richtige Stelle, an der seinen Bohrkopf ansetzen sollte. Nach Jahrzehnten erfolgreicher Entwicklung in der Automatisierung und Robotik, konnten sich die Menschen endlich auf das konzentrieren, was sie besser konnten als die Maschinen, nämlich Entscheidungen zu treffen. Nachdem die Stelle von dem Arbeiter markiert worden war, setzte der Roboter den Bohrkopf an, bohrte ein etwa zwei Meter tiefes Loch und hinterließ beim Herausziehen eine Sprengladung. Roboter und Arbeiter zogen sich dann auf eine Sicherheitsdistanz zurück und warteten die Explosion ab.

Nachdem sich der Staub etwas gelegt hatte, überprüfte der Arbeiter die raus gesprengten Brocken auf ihren Gehalt an Iridium. Er wollte gerade mit der Analyse beginnen, da hörte er Schreie, dann Waffenfeuer und wieder Schreie. Es wurden immer mehr Schreie und so beschloss er sich an die Sicherheitsabteilung zu wenden. Um zum nächsten Terminal zu gelangen, musste er eine große Halle durchqueren, doch diese war von den grässlichsten Wesen bevölkert, die er je gesehen hatte. Ihre rostfarbene, schuppige Haut war von dem Blut ihrer Opfer stellenweise bedeckt. Offenbar setzten sie ihre Schusswaffen nur im Notfall ein, sie liebten es viel mehr mit ihren eigenen Krallen zu töten und ihre Opfer anschließend auszuweiden.

Panik kroch in dem Arbeiter hoch, er wollte nur noch raus aus jener Todesfalle. So rannte er in einen dunklen Nebenstollen, an dessen Ende sich ein Fahrstuhl befand. Als er etwa die Hälfte des Weges geschafft hatte, hörte er Schritte hinter sich. Schnell drehte er den Kopf zur Seite, ohne dabei mit dem Rennen aufzuhören. Einige dieser Wesen stürmten auf ihn zu und kamen in Angst erfüllender Weise rasch näher. Nur noch wenige Meter trennten ihn von der Sicherheit, die ihm der Fahrstuhl bieten würde, aber seine Beine wurden schwer und sie taten ihm bereits weh, denn so schnell war er noch nie gerannt. Er musste nur noch diesen Knopf berühren, doch das einzige von ihm, das ihn tatsächlich berühren sollte, war ein Schwall seines Blutes, welches aus ihm austrat, als die Wesen ihn überwältigten.

Das Blut traf jedoch nicht nur den Knopf, sondern auch eine Tafel, auf der stand: „Eingang B, Iridiummine, Hawthrone, Handelsimperium.“

„Wir stehen hier wie auf einer Parade!“ meckerte Horny. Neben ihm standen Seisuke und Master Nitro und gemeinsam warteten sie auf einem abgelegenen Flugfeld. Hier konnte man unbemerkt von Passanten starten und landen und in einigen Sekunden sollten Horizonte, Misel, Rodamar, Marco und Don Bilbo aus der gerade gelandeten Maschine steigen.

„Die brauchen aber lange!“ meinte Nitro und Seisuke erklärte: „Die trödeln häufig, so sind die eben.“ Kaum hatte er diese Worte ausgesprochen, öffnete sich eine Tür des Flugzeugs und eine Treppe wurde daran geschoben. Zuerst stieg Bilbo aus, er hastete die Treppe herunter und sprang auf den Asphalt des Rollfeldes. Danach stiegen Horizonte, Rodamar, Misel und Marco gemütlich aus dem Flugzeug. Horny, Seisuke und Nitro gingen auf die anderen zu und Horny fragte Horizonte: „Warum hatte er es denn so eilig?“ „Es ist fast zwölf Uhr, es würde Unglück bringen, wenn wir zu spät kämen!“ „Glaubst du daran?“ „Zumindest bin ich jetzt ein wenig offener dafür, als vor der Begegnung mit Sir Martin.“ „Konnte das Dokument übersetzt werden?“ Don Bilbo antwortete darauf: „Der größte Teil muss noch interpretiert werden, aber was wir bisher genau wissen, ermöglichen Verbesserungen in der Warpfeldgeometrie. Dadurch können wir schneller fliegen, ohne dabei mehr Energie zu verbrauchen.“ „Wir sollten uns drinnen unterhalten.“ Schlug Misel vor. Ohne weitere Worte schlug man die Richtung zum Regierungssitz ein. Nebeneinander hergehend fragte Marco Nitro: „Alle aus der Raffinerie lebend raus gekommen?“ „Wir haben niemanden verloren, aber es hätte auch anders ausgehen können. Ich glaube wir standen noch nie vor so einer Bedrohung!“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:07 
Nach einigen Gesprächen teilte sich die Gruppe auf. Horizonte, Marco und Nitro berieten sich in Horizontes Büro. Wie immer pflegte Horizonte, sich hinter seinen Schreibtisch, vor ein Fenster zu setzen. Dadurch konnte er zwar jede Regung in den Gesichtern der ihm gegenüberliegenden Personen erkennen, aber diese hatten Probleme damit Horizontes Mimik zu interpretieren. Er breitete einige Einsatzberichte aus und begann das Gespräch: „Also, wie groß ist die Gefahr?“ Marco ließ Nitro den Vortritt und jener antwortete: „Im jetzigen Augenblick können wir die genauen Ausmaße nicht genau einschätzen.“ „Wir wissen also nichts!“ „Zumindest wissen wir, dass das PAX mindestens eine große Armee aufstellen konnte, nur wissen wir nicht, wie sie es getan haben.“ Marco ergänzte: „In einigen Stunden sollten wir etwas mehr wissen, wenn Rodamar mit der Untersuchung der ‚Zellprobe’ fertig ist.“ „Zellprobe?“ fragte Horizonte und Nitro versuchte zu erklären: „Der rechte Zeigefinger eines dieser Wesen. Ich habe ihn abgetrennt und aufbewahrt.“ Horizonte lehnte sich etwas zurück, wartete einige Sekunden und befahl dann: „Beraten sie sich beide mit General Azmodan. Stellen sie einen Notverteidigungsplan gegen eine solche Armee auf und legen sie ihn mir bis 22:00 Uhr vor.“ „Wird erledigt.“ Bestätigte Marco, dann standen er und Nitro auf und verließen das Büro.

Seisuke und Horny waren beide auf dem Weg zur Cafeteria, als Seisuke versuchte ein Gespräch einzuleiten: „Irgendwie haben die sich komisch benommen!“ „Wer denn?“ „Unser Herr Prätor und Misel.“ „Hab ich nicht bemerkt.“ „Doch, da ist irgendwas im Busch.“ „Was meinst du denn genau?“ „Die beiden haben sich die ganze Zeit nicht einmal angesehen, nicht mit einander gesprochen und einen möglichst großen Abstand zueinander eingehalten.“ „Vielleicht bildest du dir das nur ein.“ „Horny, Misel hat mich eben noch gebeten, alle Termine mit Horizonte in dieser Woche zu übernehmen, weil sie wohl so viel im Außenministerium zu tun hätte.“ „Kann doch sein.“ Vermutete Horny, aber Seisuke setzte fort: „Nur ein paar Minuten später hat mich Horizonte gefragt, ob ich nicht seine Termine mit Misel übernehmen könnte, weil er so viel mit dem Phoenixrat zu besprechen hat, dass er sich nicht um Allianzprobleme kümmern kann.“ „Gut, dass ist schon merkwürdig, aber ich würde mir da nicht zu viel daraus machen, vor allem geht es dich doch gar nichts an.“ „Ich werde mal mit Rodamar sprechen, der hat die beiden nach diesem Kampf untersucht, vielleicht weis er ja mehr.“ „Ich halte es noch immer für nicht besonders klug, aber mach was du nicht lassen kannst.“

Rodamar beendete gerade eine DNS-Analyse, als Horizonte das Krankenrevier betrat. „Ich habe mir gedacht, dass sie dies hier interessieren wird.“ Begrüßte Rodamar ihn. Horizonte kam näher und fragte: „Was haben sie herausgefunden, Doktor?“ „Zuerst einmal will ich loswerden, dass eine Blutprobe vollkommen ausreichend gewesen wäre.“ „Major Nitro hatte wenig Zeit und der Besitzer des Fingers war bereits tot und brauchte ihn deshalb auch nicht mehr.“ „Wie auch immer, die Haut ist jedenfalls reptilienartig, was eigentlich auf einen Kaltblüter deuten würde, jedoch befindet sich eine recht dicke Fettschicht unter dieser Haut. Diese Fettschicht isoliert aber, hält also die Wärme im Körper, lässt aber auch nur wenig Wärme von außen, zum Beispiel durch Sonnenstrahlen, in den Körper. Wäre dieser Mann ein Kaltblüter, wäre er wohl erfroren.“ „Also war er Warmblüter?“ „Genau, ich konnte mir dies nicht richtig erklären, also wartete ich auf die Resultate des ersten DNS-Tests. Durch sie konnte ich erkennen, dass diese Spezies keine natürlich entstandene Rasse ist, sondern geklont wurde. Teile der DNS wurden fast eins zu eins von Menschen, andere von Praios übernommen. Ich fand auch einige andere Modifikationen an der DNS, die wohl so niemals in der Natur vorkommen würden.“ „Was meinen sie?“ „Sie wissen, dass in jeder Zelle, der vollständige genetische Code vorhanden ist, es sind aber nur einpaar Gene aktiv. Dadurch braucht man nicht die genauen Spezifikationen jeder Zelle des Körpers zu kennen, um eine Kopie zu erstellen.“ „Worauf wollen sie hinaus?“ „Ganz einfach, ich habe die Aktivierung verschiedener Gene dieses Wesens simuliert und es kamen einige interessante Ergebnisse dabei heraus. So sind diese Wesen in der Lage beinahe das gesamte elektromagnetische Spektrum zu sehen.“ „Über das sichtbare Licht hinaus?“ „Mehr noch als nur unsichtbares Licht wie ultra-violette Strahlung, die können sogar Radiowellen sehen!“ „Leider habe ich noch einiges zu erledigen, also stellen sie einen Bericht zusammen und senden sie ihn an General Azmodan und einmal an mich.“ „In einer Stunde müsste ich so weit sein.“ „Gut gemacht, Doktor.“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:08 
Seisuke öffnete die Tür und gesellte sich zu den anderen beiden. Rodamar fragte: „Was kann ich für sie tun?“ „Sie sollten sich mal mein Auge ansehen, es schmerzt noch ein wenig.“ Antwortete Seisuke und Horizonte verabschiedete sich: „Noch einen guten Abend die Herren.“ Dann ging er hinaus. Mit einer Taschenlampe leuchtete Rodamar in Seisukes Pupillen und fragte: „Wie fühlt sich dieser Schmerz denn genau an?“ Seisuke gab verlegen zu: „Eigentlich habe ich gar keine Schmerzen.“ „Was haben sie dann?“ „Eine Frage.“ „Dann schießen sie mal los.“ „Als sie Prätor Horizonte und Misel in Minas Morgul untersuchten, kam ihnen da an den beiden etwas komisch vor?“ „Darüber darf ich nicht sprechen, ärztliche Schweigepflicht.“ „Sie würden so etwas nicht sagen, wenn da nicht etwas vorgefallen wäre.“ „Wenn sie es unbedingt wissen wollen, dann fragen sie doch einen der beiden.“ „Das werde ich auch tun.“ Daraufhin verließ Seisuke das Krankenrevier und Rodamar wollte gerade damit beginnen seinen Bericht zu verfassen, als Misel herein kam.

Es klopfte an die Tür der Wohnung des Prätors. „Herein!“ rief Horizonte und Seisuke trat ein. Er kam näher und erkannte, dass Horizonte einige Berichte, wahrscheinlich aus der letzten Woche, studierte. „Ist irgendetwas, Seisuke?“ „Das wollte ich dich eigentlich fragen.“ „Wieso, mir geht es doch ausgezeichnet.“ „Du wolltest mit Misel für mindestens eine Woche nichts zu tu haben und sie wollte genau das Gleiche. Also ich sag es mal so, du könntest mir jetzt irgendeinen Scheiß erzählen oder auch gar nichts, dann würde ich aber einige Theorien aufstellen und sie mit Horny, Purpur und den anderen diskutieren. Du kannst entscheiden ob du das willst, oder mir einfach nur die Wahrheit erzählen willst.“ Horizonte seufzte und legte dabei die Berichte weg. Er dachte einige Sekunden nach und sagte dann: „Du lässt einem wenige Möglichkeiten. Aber was ich jetzt sage, muss unter uns beleiben, auch Misel sollte besser nicht davon erfahren, dass ich dir das hier erzählt habe.“ „OK, ich werde es niemandem erzählen.“ „Na gut. Nach dem Kampf mit Sir Martin habe ich Misel vorgeschlagen etwas zu trinken, sie nahm das Angebot an. Wir gingen zur Bar und Misel bestellte einige Flaschen Whiskey, Wodka und noch etwas an dessen Namen ich mich gar nicht mehr erinnern kann. Jedenfalls gingen wir auf ihr Zimmer, weil meines total demoliert war und wir tranken.“ „Viel?“ „Zuviel! Das nächste an was ich mich erinnern kann ist, dass ich neben Misel nackt in ihrem Zimmer aufgewacht bin. Ich hatte für einige Momente zumindest die Hoffnung noch unbemerkt verschwinden zu können, doch sie wachte auch auf.“ „War sie auch nackt?“ „Ja, nun nachdem wir uns, oder besser sie mich, angeschrieen und runter gemacht hatte, versuchten wir uns den Rest der Woche erfolgreich aus dem Weg zu gehen. Ich dachte, dass niemand Verdacht schöpfen würde, doch schon Rodamar hat mich so gründlich untersucht, dass er den Alkoholkonsum und einen blauen Fleck entdeckte, der von einem von Misel’s Schuhen, den sie mir hinterher geworfen hatte, herrührte. Aus irgendeinem Grund glaubte er mir nicht, dass der blaue Fleck von dem Kampf stammte, er war wohl zu frisch oder so.“ „Also hast du ihm erzählt was passiert ist?“ „Zuerst nicht, aber drohte über meinen Hormonhaushalt raus zu finden, ob ich in den letzten 24 Stunden Sex hatte und das wollte ja noch nicht mal ich herausfinden.“ „Früher oder Später wird sie dir schon verzeihen!“ Seisuke drehte sich um und wollte die Wohnung verlassen, als es klopfte. Horizonte rief wieder: „Herein“ und Misel trat ein. Etwas überrascht sagte Seisuke: „Es ist wohl eher Früher als Später.“ Misel war verwirrt und fragte nur: „Was, wie meinst du das?“ „Ach nicht so wichtig, Nacht miteinander.“ Horizonte und Misel sagten etwa gleichzeitig: „Nacht.“ Dann wand sie sich Horizonte zu: „Ich war eben noch mal bei Doktor Rodamar.“ „Ich habe keine Krankheiten, mit denen ich dich angesteckt haben könnte.“ „Ich würde das keine Krankheit nennen, aber irgendwie angesteckt hast du mich schon mit etwas.“ „Was willst du damit sagen?“ Misel holte tief Luft und sprach es dann aus: „Ich bin schwanger!“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:10 
Die Prophezeiung

Ein Kloster in Anatolien, Vorderasien, ca. 3000 v. Chr.

Der gesamte Raum war erfüllt von dem Duft esoterischer Öle, welche die Priester den Kerzen bei der Herstellung hinzufügten. Jeden erschlug dieser Geruch beinahe, wenn er unvorbereitet eintrat, die Priester jedoch beabsichtigten einen anderen Effekt. Gepaart mit einer tiefen Meditation lösten die eingeatmeten Öle Visionen aus. In der Mitte des Raumes betete gerade der Oberpriester, als ein anderer Priester ihn zum Essen holen wollte. Er versuchte ihn anzusprechen, doch der Oberpriester reagierte nicht, also fasste er ihm an die rechte Schulter, da schnellte dessen Kopf zurück. Der Oberpriester blickte leer an die Decke, etwas Schaum hatte sich an seinem Mund gebildet und die Arme spreizte er verkrampft von seinem Körper ab. Der Priester machte verängstigt einen Schritt zurück, er wollte etwas sagen, doch der Oberpriester begann zu sprechen: „Wenn fünftausend mal die Sonne so hoch wie sonst nie geschienen hat, wird ein Weib geboren, die den gebären wird, der einst die Kinder der Götter zum Sieg über deren Väter, die Götter selbst, führt. Dieses Weib wird unwissend sein und ihr werdet sie an ihrem Inneren erkennen. Ihr Inneres lautet: ATGCGCTAGCTAATCGCGATGCGC…“

Die Wohnung des Prätors in Vorgon City, Erde2, etwa 12,5482 Millisekunden nachdem Misel Horizonte von ihrer Schwangerschaft erzählt hat.

„Was?“ fragte Horizonte erschüttert. Misel stand noch immer und wiederholte, dabei jedes Wort stark betonend: „Ich bin schwanger!“ „Von mir?“ fragte Horizonte, diesmal ängstlich. „Von wem denn sonst?“ „Kann man das nach einer Woche bereits feststellen?“ „Natürlich, wir leben im 21. Jahrhundert. Wenn ich Zahnschmerzen haben, geh ich doch auch nicht mehr zum Schmied und Doktor Rodamar macht seine Untersuchungen sehr gründlich.“ Horizonte stand auf, murmelte etwas Unverständliches und sah dann erst die Koffer neben Misel. „Was sind denn das für Koffer, Misel?“ „Na ich werde hier einziehen!“ „Was?“ „Du wiederholst dich.“ „Was?“ „Siehst du schon wieder.“ „Wieso willst du hier einziehen?“ „Weil du mich geschwängert hast.“ „Was?“ „Kannst mal damit aufhören?“ „Du willst hier einziehen weil ich dich geschwängert habe?“ „Ja, hier kann ich dich dafür bestrafen!“ „Ich dachte immer dazu würden zwei gehören, also was ist mit dir selbst?“ „Ich bekomm schon das Kind, wenn du mal wissen willst wie sich das anfühlt, dann versuch mal eine Apfelsine zu scheißen! Außerdem hattest du die Idee mit dem Alkohol, dann hast du hier genug Platz und ich will nicht, dass das Kind ohne Vater aufwächst.“ „Ja gut, vielleicht ist es jetzt nicht gerade gut das zu fragen, aber hast du an eine Abtreibung gedacht?“ „Kommt nicht in Frage, das ist in Ankh Morpork illegal. Bei einer Bevölkerung von 90% Frauen und 10% schwulen Männern könnte die Stadt anders nicht überleben!“ „In der Vorgonischen Republik ist es erlaubt bis zu einem bestimmten Alter des Fötus.“ „Ich bin das Stadtoberhaupt, wie sieht denn das aus, wenn ausgerechnet ich dagegen verstoße, weil es in der Heimat des Vaters erlaubt ist. Dazu kommt, dass ich es unbedingt will, bei meinem Job bin ich so beschäftigt, dass ich sonst niemals zu einem Kind gekommen wäre.“ „Na gut, aber was wird denn aus deinem Job?“ „Ankh Morpork ist doch nur zehn Minuten mit einem Antigrav-Flugzeug entfernt und ansonsten übernimmt meine Vertretung und mein Bruder kümmert sich um meine Wohnung.“ „Du hast einen Bruder?“ „Ja, das ist jetzt nicht so wichtig.“ Misel nahm einen Koffer in die Hand und fragte: „Wo ist denn mein Schlafzimmer?“ „Hier gibt es nur eines und das gehört mir.“ „Jetzt ist es mir.“ „Das ist meine Wohnung!“ „Willst du dich mit mir anlegen?“ „Nein, aber warum übernachtest du nicht solange woanders bis ein zweites Schlafzimmer für dich eingerichtet ist?“ „Weil ich eben etwas von bestrafen erzählt habe und du kannst doch auf der Couch schlafen!“ „Und warum schläfst nicht du auf der Couch?“ „Willst du eine hochschwangere Frau auf einem unbequemen Sofa schlafen lassen?“ „Du bist erst eine Woche schwanger und nicht im neunten Monat!“ „Das ändert nichts daran, dass du auf der Couch schläfst! Also wo ist das Schlafzimmer?“ „Da drüben, daneben ist gleich das Bad. Morgen früh haben wir ein Meeting mit Seisuke und General Azmodan, also verschlaf nicht, ich werde es bestimmt nicht.“ Misel ging auf das Schlaffzimmer und sagte kurz bevor sie darin verschwand: „Dann bis morgen früh, Nacht.“ „Nacht.“ Antwortete Horizonte ziemlich mürrisch, drehte sich zum Sofa um und betrachtete ungläubig sein heutiges Nachtlager.


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:11 
Die Sonne war gerade aufgegangen, Horizonte und Misel kamen zu spät in seinem Büro an, denn Seisuke und Azmodan waren bereits anwesend. Misel setzte sich zu den anderen beiden vor den Schreibtisch, Horizonte lies sich ziemlich langsam und verkrampft in seinen Stuhl sinken. Seisuke fragte besorgt: „Ist mit dir irgendwas passiert, Strelo?“ „Sind nur Rückenschmerzen. Ich hab heute Nacht etwas schlecht auf der Couch gelegen und werde nachher mal bei Rodamar vorbei sehen, vielleicht kann er mir ja helfen.“ „Wie ist es denn dazu gekommen.“ „Ist eine lange Geschichte, aber wir haben jetzt etwas Wichtigeres zu tun. General Azmodan hat einen Verteidigungsplan aufgestellt. Seisuke, als Verteidigungsminister der Hadals, solltest du ihn auch für die Nicht-Phoenix-Einrichtungen umsetzen. Misel und ich werden zur Ratsversammlung auf die Pegasus fliegen, dort werde ich dem Rat neben anderen Dingen auch die neuesten Berichte über die Angriffe des PAX-Konkordats vorlegen können. Dann kann ich die Durchsetzung des Verteidigungsplanes außerhalb des Planeten beantragen. Irgendwelche Fragen?“ Seisuke regte sich und sagte: „Wann kommt ihr denn wieder?“ „Das wird nur einige Stunden dauern. Schätze, dass wir heute Abend wieder da sind, keine Sorge meine Verwaltungsarbeit musst du nicht erledigen.“ Seisuke und Azmodan verließen den Raum. Sobald sich die Tür geschlossen hatte fragte Misel: „Warum muss ich denn mit?“ „Weil du schwanger bist. Alles Weitere wird dir schon klar werden, wenn wir oben sind. Nun muss ich aber zu Rodamar, diese Rückenschmerzen bringen mich noch um.“

Nachdem sie das Büro verlassen hatte, traf Misel Azmodan. Sie fragte ihn: „Was hat das eigentlich mit dieser Ratsversammlung zu bedeuten?“ „Der Phoenix-Rat ist das höchste Gremium des Projektes und eigentlich steht dem Prätor seit einigen Jahren ein Platz darin zu.“ „Und warum hat er keinen?“ „Weil er hauptverantwortlich für die Entstehung des PAX war und als das Konkordat sich vom Phoenix abwendete lastete man das ihm an. Eigentlich erledigt er bereits die Aufgaben, die er dann hätte, man gibt ihm nur keine Stimme im Rat und nicht die Gehaltserhöhung.“ „Gehaltserhöhung?!“ „Natürlich verdient er dann mehr. Dieses Jahr hat er meiner Meinung nach die besten Chancen in den Rat aufgenommen zu werden. Denn durch den Seitenwechsel des Medaron, der Zerstörung einer der größten Sauerstoffraffinerien und einer neuen Armee des PAX und einigen wichtigen Erkenntnissen aus Dokumenten der Alten und Ersten, ist unser Ziel, die Rettung der Erde so nah wie nie zuvor.“

„Wir haben die Atmosphäre verlassen und werden in einigen Minuten an der Pegasus andocken.“ Meldete der Pilot des Frachtschiffes. Misel und Horizonte hatten hinter den beiden Piloten platz genommen. Den Kommentar hätte sich der Pilot eigentlich sparen können, denn durch ein Fenster auf der Seite konnte man den Planeten sehen, mittlerweile war seine Krümmung klar zu erkennen und Misel schluchzte. Neugierig fragte Horizonte: „Ist irgendwas?“ „Er sieht ihr verdammt ähnlich.“ „Wer sieht wem ähnlich?“ „Der Planet, Erde2, sieht der Erde zum verwechseln ähnlich. Das letzte mal, dass ich so einen Planeten gesehen habe, war als ich hierher gereist bin. Als ich die Erde mit einem Kolonieschiff hinter mir ließ und hoffte auf Erde2 zu finden, was ich in meiner alten Heimat so lange vergeblich gesucht habe.“ „Und was hast du gesucht und hast du es eigentlich gefunden?“ „Na alles sag ich dir doch nicht!“ „Dann eben nicht.“ Horizonte drehte sich wieder weg und sah nach vorne. Dort kam der Mond immer näher, hinter dem sich die Pegasus und ihr Schwesterschiff Prometheus vor den Blicken und Sensoren des Planeten versteckt hielten. Nach einigen Sekunden des Schweigens fragte Misel: „Wie geht es eigentlich deinem Rücken?“ „Besser seit ich bei Rodamar war. Aber ich weis jetzt, dass ich unbedingt ein Bett brauche.“ „Bei mir schläfst du nicht mehr, du weist, was da raus gekommen ist.“ Der Co-Pilot drehte sich um, als könne er nicht glauben, was er gerade gehört hatte. Horizonte kam jeder Frage zuvor: „Hören sie beide mal her, über was hier gesprochen wird, das fällt unter die strengste Geheimhaltungspflicht, verstanden?“ Der Co-Pilot drehte sich wieder nach vorne und beide Piloten antworteten gleichzeitig: „Ja, Sir.“ Dann wendete sich Horizonte wieder Misel zu und setzte fort: „Heute früh hab ich veranlasst, dass man das kleine Zimmer rechts neben dem Bad zu einem weiteren Schlafzimmer umbaut. Du kannst dich entscheiden, welches du willst.“ „Klar will ich das große Zimmer, aber wenn wir schon mal dabei sind, das Kind bräuchte auch einen.“ „Willst du nicht erstmal ein paar Wochen warten, du bist erst eine Woche schwanger.“ Einer der Piloten konnte sich einen Lachanfall nicht mehr verkneifen und sank in seinem Stuhl zusammen. Horizonte sah wieder nach vorne und fragte zornig: „Gibt es irgendetwas über das wir vielleicht alle lachen sollten?“ Der Pilot wurde plötzlich wieder ernst und antwortete: „Nein, Sir.“ Nur wenige Sekunden danach berichtete der Co-Pilot: „In zwei Minuten docken wir an.“ Recht schnell schob sich der Mond, der etwa ein Viertel so groß wie der Mond der Erde war, an dem Fenster vorbei und dahinter konnte man die Pegasus und weiter entfernt die Prometheus erkennen. „Sie sieht so klein aus.“ Meinte Misel und Horizonte antwortete mit einem Lächeln: „Sie wird bald größer werden.“ Als sie näher gekommen waren, verlangsamten die Piloten den Flug. Nun konnte man mehr Details erkennen und Misel wunderte sich: „Warum sind so viele Menschen draußen auf der Hülle.“ Horizonte veränderte seine Position um einen besseren Blick zu haben und antwortete: „Sie bereiten die Montage vor.“ „Was wollen die denn montieren?“ „Das was wir mitbringen. Neutronen- und Protonensequenzer, Schild- und Stromgeneratoren und eine weitere eine weitere Panzerschicht aus einer Iridiumlegierung für die gesamte Außenhülle. Wenn das Schiff danach nicht von alleine explodiert, dann können wir auch Azmodan’s Plan ausführen.“ „Davon hab ich aber nichts gelesen um was geht es denn?“ „Das werde ich nun dir nicht verraten, na gut, gleich erfährst du es vor dem Rat ja doch.“ „Gut so, wo kommen wir schon hin, wenn du Geheimnisse vor mir hättest.“ „Hey, du verrätst doch auch nicht alles.“ „Ich bin auch eine Frau, du kennst doch den Spruch oder?“ „Ja ‚Der Himmel ist blau, der Regen ist nass und Frauen haben Geheimnisse.’“ Eine kleine Erschütterung signalisierte das Andocken des Frachtschiffes


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:12 
Azmodan, Marco, Demonhound, Don Bilbo und Purpur saßen in Seisuke’s Büro, als dieser mit einem Kaffee in der Hand herein kam. Er setzte sich und wollte eigentlich zu sprechen anfangen, da fiel ihm Purpur auf: „Purpur, was willst du hier?“ „Weil ich an dieser Konferenz teilnehmen will, natürlich.“ Antwortete er. „Aber du bist nicht die Vertretung von Misel im Bezug auf Ankh Morpork.“ „Und auch nicht als Vertretung als Diplomatin.“ Warf Demonhound bissig ein. Seisuke macht weiter: „Also warum bist du hier?“ „Bei dieser Konferenz geht es doch um die Sicherheit der Allianz, also geht mich das doch auch an.“ „Aber nur, wenn du ein Allianz-Amt inne hast oder wenigstens Oberhaupt einer Stadt bist.“ „Bin ich doch.“ „Wirklich? Wie viele Einwohner hat denn deine Stadt?“ „Bisher beträgt die Einwohnerzahl eins, eigentlich 1,5 wenn ich die tote Bisamratte mitzähle. Das klingt jetzt nicht nach viel, aber ich erwarte einen exponentialen Anstieg in den nächsten Tagen.“ „Ja, gleich hinter der östlichen Hügelkette hab ich ganz billig Land erstanden.“ Marco fiel etwas ein: „Das sind doch alles Sümpfe oder?“ „Ja jetzt noch aber bald wird dort eine Stadt stehen, wie ihr sie noch nie gesehen habt.“ Antwortete Purpur. „Warst du eigentlich schon mal dort?“ „Einmal hab ich sie mir von den Hügeln aus mit einem Fernglas angesehen, aber weiter wollte ich nicht, weil ich dann die Hügel ja wieder rauf müsste und dann war da noch dieser Stacheldrahtzaun mit den seltsamen Schildern.“ „Das sind Biogefahrwarnschilder, die Sümpfe sind künstlich. Vor vielen Jahren war das ein Friedhof für die Praios und wenn die Schlangen verwesen, dann sondert ihre Milz ein extrem starkes Nervengift ab. Wenn ich wetten müsste, dann ist diese Bisamratte daran verreckt.“ „Kann man da was machen?“ fragte Purpur besorgt und Seisuke antwortete: „Man könnte das Land entgiften, aber die militärischen Teams kannst du zurzeit nicht bekommen oder General Azmodan?“ „Nein, wir brauchen sie dringend für die ABC-Abwehr, vielleicht bekommt man noch zivile Firmen?“ erklärte Azmodan. Demonhound sagte darauf: „Das wird aber teuer, die einzigen zivilen Entgiftungsteams in der Gegend kommen aus Vorgon City.“ „Vielleicht sollte er mal Misel fragen, die hat Horizonte ja sowieso in der Hand. Oh ähm, vergesst was ich gerade gesagt habe.“ Stotterte Seisuke und nach einer kurzen aber sehr stillen Pause äußerte Purpur: „Ach Mann, was ist denn das nur für ein Shit. Wenigstens hab ich jetzt einen Namen für die Stadt.“ Um nicht zuviel Zeit verstreichen zu lassen, ging Seisuke zum Tagesthema über: „Gut zuerst darf ich General Marco gratulieren, er wird unser neuer Innenminister, Glückwunsch und des weiteren darf ich Don Bilbo hiermit zum Wirtschaftsminister erklären, ebenfalls alles Beste.“ Nach einem langen Applaus und vielen Glückwünschen setzte man die Konferenz wie geplant fort.

Horizonte und Misel traten in einen großen dunklen, runden Raum ein. Nachdem die Tür geschlossen wurde, erschienen 6 Personen vor ihnen. Sie strahlten und waren durchsichtig und ab und zu flackerte einer. „Hologramme?“ fragte Misel und Horizonte antwortete: „Ja, das sind Subraum-Übertragungen in Echtzeit zur Erde und ins Zentauri-System. Wir werden übrigens auch gerade dort als Hologramme dargestellt.“ „Cool, können die uns eigentlich auch hören.“ Ein Mann sagte darauf: „Natürlich, das hätte wenig Sinn, da ich keine Zeichensprache beherrsche.“ „OK, hab es verstanden.“ „Ist sie das?“ fragte eine Frau. Misel wunderte sich und wollte etwas fragen, doch Horizonte ergriff zuerst das Wort: „Ja, dies ist Misel und sie ist schwanger.“ „Hey, das muss nun wirklich nicht jeder wissen.“ Beschwerte sich Misel. Dann fragte die Frau wieder: „Wer ist der Vater?“ „Das bin ich.“ Gestand Horizonte ein. Ein Raunen ging durch die Hologramme und dann sagte die Frau: „Na gut, nicht perfekt, aber auch so müsste sich die Prophezeiung erfüllen.“ „Was für eine Prophezeiung?“ fragte Misel erbost. Horizonte dreht sich zu ihr und erklärte: „Vor 5000 Jahren prophezeite ein akkadischer Priester, dass in 5000 Jahren, also jetzt, dass eine Frau erscheinen wird, die den Mann gebären wird, der einmal den Konflikt zwischen den Alten und den Ersten beenden wird. Um die Frau zu erkennen gab er eine wirre Buchstabenfolge von sich und erst im 20. Jahrhundert entdeckte man, dass es sich dabei um einen DNS-Code handelt. Deinen DNS-Code, Misel.“ „Meinen?“ antwortete sie leise. „Ja, weil man sich nicht sicher war diese Frau zu finden, entschloss man sich etwa um das Jahr 1975 diese Frau zu klonen. Nach vielen missglückten Versuchen schafften sie es Mitte der 80er Jahre einer Frau eine speziell codierte Eizelle zu implantieren und daraus wurdest dann du.“ „Du willst mich verarschen, ich soll nicht mal mit meinen Eltern verwandt sein?“ „Wir haben keine Ahnung wer deine eigentlichen Verwandten sind oder ob sie überhaupt existieren, denn es könnte sein, dass der Priester selbst diese Möglichkeit, dass du künstlich geschaffen wirst, mit gesehen hat, aber da sind wir uns nicht sicher.“ „Ich finde das grausam und verabscheuungswürdig.“ „Ich auch.“ „Und warum hast du nichts dagegen unternommen?“ „Weil wir ungefähr gleich alt sind und ich gerade mal geboren war?“ „Dir fällt auch immer eine Ausrede ein oder?“ Die Frau unterbrach die beiden wieder: „Seid ihr irgendwie bereits verheiratet? Jedenfalls hört es sich so an. Wichtiger ist jetzt, dass sie geschützt wird.“ „Wenn sie das PAX oder jemand anders direkt umbringen wollte, dann hätten sie es bereits getan. Sie fürchten sich vor Konsequenzen, wenn sie direkt gegen die Prophezeiung verstoßen.“ Warf Horizonte ein und Misel äußerte: „Aber du wolltest mich doch mal umbringen.“ „Ich hätte dich nie getötet. Das PAX hat aber einen Punkt der Prophezeiung zerstört und deswegen hab ich so viel Ärger bei deinem Eintritt in das Phoenix-Projekt bekommen.“ „Was war denn das für ein Punkt?“ „Die Frau sollte unwissend sein und nun weist du aber bescheid. Deshalb sollte die Prophezeiung jetzt nicht mehr gültig sein.“ „Aber ihr seit euch da nicht mehr so sicher, warum sonst würdet ihr so einen Wind um meine Schwangerschaft machen!“ „Richtig, dein Sohn.“ „Unser Sohn.“ Korrigierte ihn Misel und Horizonte setzte fort: „Unser Sohn ist die beste Chance die Erde zu retten und das gibt man nicht einfach auf.“ „Nun sollten wir uns den Angelegenheiten des Rates widmen.“ Schlug ein Mann vor und ein anderer sagte: „Wir haben uns entschieden Sie, Prätor in Anerkennung ihrer Verdienste in den Rat aufzunehmen. Ab sofort haben sie alle Rechte, Privilegien und Pflichten wie wir anderen auch.“ „Und das höhere Gehalt kann er jetzt als Vater gut gebrauchen.“ Unterbrach ihn Misel. „Sie soll ruhig sein, ich bin noch nicht fertig. Prätor, sie bleiben bis zum Tod oder bis eine absolute Mehrheit sie abwählt ein Mitglied dieses Rates.“ Horizonte trat einen Schritt vor und sagte: „Danke und als erste Amtshandlung schlage ich die Verlegung der USS Interceptor nach Erde2.“ Eine Frau sagte darauf: „Die Interceptor ist ein Prototyp, sie hat nur weinige High-Warp-Testflüge hinter sich und sie wollen sie in eine unruhige Region verlegen?“ „Wir sehen uns mit den neuen Soldaten des PAX einer bisher nie da gewesenen Bedrohung gegenüber. Wenn wir hier nicht untergehen wollen müssen wir herausfinden, wo das PAX diese Soldaten herhat. Bisher wissen wir, dass sie geklont wurden, aber das PAX ist extrem geschwächt, seit mehrere große Allianzen ausgetreten sind und kleiner Mitglieder von Konkurrenten wie dem Handelsimperium abgeworben werden. Sie greifen vor allem ihre Konkurrenten an, jedoch wissen wir nicht wie sie diese Soldaten unbemerkt an den Wachen vorbeigebracht haben und weil das PAX keine Ressourcen mehr besitzt, um diese Truppen auszubilden, muss jemand anderes sie klonen. Unser Top-Agent Viruz ist bereits dabei und solange können wir nur die Waffentransporte der Bre’ouri unterbinden. Doch die Bre’ouri Frachtschiffe sind sehr schnell, wesentlich schneller als unsere beiden Schlachtschiffe und hier kommt die Interceptor auf den Plan, sie fliegt den Transporter an und aktiviert ihren Subraumstörfeldgenerator. Wenn die Warpfelder der beiden Schiff dann ausfallen, können die Schlachtschiffe das Frachtschiff durchsuchen.“ „Wann soll denn dieser Transport stattfinden?“ fragte ein Mann. „In zehn Tagen.“ „So schnell ist auch die Interceptor nicht, sie würde die 11 Lichtjahre von der Erde aus nur in 3 Monaten schaffen.“ Horizonte ging zu einem Computerterminal und rief einen Text auf, dann sagte er: „Nicht mit diesen Modifikationen der Warpfeldgeometrie, die wir aus einem Dokument des Medaron erhalten haben. So kann es die Interceptor sogar in nur 8 Tagen schaffen.“ „Das ist noch nicht getestet!“ warf ein anderer Mann ein. Horizonte drehte sich zu dessen Abbildung und antwortete darauf: „Dann sollten wir aber schleunigst einen 8 Tage-Testflug ansetzen!“ „Auch wir waren nicht ganz untätig.“ Konterte der Mann und setzte fort: „Wir konnten die Phasengewehre vorzeitig zur Serienreife führen, mit der Interceptor werden sie 200 davon erhalten.“ „OK, dann sind wir uns ja einig.“ Beendete eine Frau die Sitzung.

In der Hauptstadt des PAX-Konkordats trafen sich zwei Männer, einer hatte eine Flasche Champagner dabei und füllte zwei Gläser. Viruz beobachtete beide durch einen Türspalt und hörte ihr Gespräch mit: „Schon bald sind alle unsere Feinde besiegt.“ „Sie werden geradezu dahingeschlachtet.“ „Als nächste sind die Hunde von den Hadals dran, wenn sie beseitigt sind, dann geht auch das Phoenix-Projekt hier auf Erde2 zu Grunde.“ „Und dann ist das Gleichgewicht der Kräfte auf dem Planeten wieder hergestellt.“ „Und das Konkordat kann sich endlich öffentlich zum Beitritt zur Balance of Power bekennen.“ „Das wird eine geniale Feier in den Trümmern der Hadals!“ „Oh ja.“

Viruz öffnete die Tür, stürmte in den Raum, zog zwei Pistolen und sagte: „Doch ihr werdet sie nie erleben.“ Dann schoss er wild um sich.


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:13 
Der Überfall

„Warum bin ich schon wieder hier? Zweimal in zwei Wochen ist zweimal zu viel!“ beschwerte sich Misel. Sie und Horizonte saßen im Archiv der Pegasus an einem Tisch sich gegenüber und sichteten Kopien und Originale antiker Texte. Ohne aufzublicken fragte Horizonte: „Was hast du denn gegen das Schiff?“ „Gegen das Schiff nichts, aber beim letzten Mal hab ich erfahren, dass ich in einem Reagenzglas gezüchtet wurde!“ „Und das kurz nach deiner Schwangerschaftsbestätigung.“ „Nach dem ich bei dir eingezogen bin.“ „Und danach hat man dir erzählt, dass du in einer Prophezeiung erwähnt und zur modernen Maria wirst.“ „Irgendwie scheine ich Katastrophen anzuziehen.“ Stöhnte Misel deprimiert, fing sich aber wieder und fragte: „Wieso tun wir dies hier eigentlich?“ Immer noch nicht aufblickend antwortete Horizonte: „Weil wir so herausfinden wollen, ob die Vorraussetzungen für die Erfüllung der Prophezeiung noch gegeben sind.“ „Und warum?“ „Wenn sich nichts Größeres ändert, dann würden wir die Zukunft kennen, bevor sie zur Gegenwart wird.“ „Das bringt doch nichts, ist alles Humbug! Nicht wahr Schatzilein?“ Jetzt sah Horizonte auf und in ein ziemlich gemein grinsendes Gesicht. Misel kam jedem Wort zuvor: „Damit hast du jetzt nicht gerechnet und schon ist bewiesen, dass dies hier nichts bringt!“ „So funktioniert das auch nicht.“ Erwiderte Horizonte kleinlaut und las wieder in einem Buch. Nur einige Sekunden später fragte dann Misel: „Und wie funktioniert es dann, dir muss man echt alles aus der Nase ziehen!“ „Na so.“ antwortete Horizonte und drehte das Buch so, dass Misel den Text sehen konnte. Er erklärte: „Das ist ein altägyptischer Text, auf der linken Seite eine Originalkopie und auf der rechten die Übersetzung.“ „Das ist kein ägyptischer Text, sind gar keine Hieroglyphen.“ „Es ist einer, Hieroglyphen wurden nur für religiöse Sachen verwendet wie Grabmäler und so. Das hier ist hieratisch, die Schrift des altägyptischen Alltags.“ „Na gut und?“ „Hier wird von der Mutter des Schicksals gesprochen und ihr Name ist Mi’ißal.“ „Zufall nichts weiter. Wenn ich unbedingt danach suche, dann finde ich wahrscheinlich auch einen Text in dem steht, dass Strelo ein Riesenarsch ist!“ „Das Schatzilein hat mir besser gefallen, aber lass dich ruhig aus und wenn du dich dann beruhigt hast, kannst du ja mal die rote Mappe lesen.“ Misel hob die rote Mappe links neben ihr auf und fragte schließlich: „Was ist denn da drin?“ „Die Kopie einiger Passagen der Bibel, welche von Kaiser Konstantin gestrichen wurden, als er das Christentum zur Staatsreligion im römischen Imperium ernannte. Die Originale liegen zurzeit im Archiv des Vatikan unter strengstem Verschluss, weil darin vom Untergang des Glaubens geschrieben wird.“ „Wahrscheinlich soll ich daran auch noch schuld sein!“ sprach Misel und lehnte sich beleidigt zurück. Horizonte war gleichermaßen genervt und besorgt, also versuchte er sie zu ermuntern: „Lies es, vielleicht steht ja drin, dass die Prophezeiung gar nicht stimmt.“ „Das ändert aber nichts daran, dass ich gezüchtet wurde, schwanger bin und bei dir wohne. Nur diese Messiasgeschichte wäre damit erledigt. Eins von vier Problemen beseitigt, ich werde mich gleich voller Tatendrang an diesen Schriebs machen und ihn hysterisch lesen.“ Spottete Misel und Horizonte entgegnete: „Sarkasmus steht dir nicht gut.“ „Aber Whiskey und Wodka. Mir wird schon wieder ganz übel, diese Schwangerschaft kotzt mich jetzt schon an.“ „Die morgendliche Übelkeit tritt nicht nach bereits drei Wochen Schwangerschaft auf.“ „Darin bist du wohl der Experte!“ „Es wird wohl eher daran liegen, dass wir uns in einem Schiff befinden, welches zum ersten Mal mit mehr als fünfzigfacher Lichtgeschwindigkeit fliegt. Da kann man nicht erwarten, dass es ein ruhiger Flug wird.“ „Ich schon.“ Plötzlich erschütterte das Schiff. Misel war sichtlich genervt und fragte grimmig: „Und was war das jetzt gerade?“ „Wir sind wohl aus dem Warp raus.“ Vermutete Horizonte und kurz darauf ertönte durch die Bordlautsprecher: „Achtung, alle Mann auf die Kampfstationen.“ Der Satz wiederholte sich noch einmal, Horizonte stand auf und sagte zu Misel: „Wir sollten auf die Brücke.“



„Du wirst nicht mit ihm ausgehen.“ Befahl Azmodan in militärisch zackigen Ton. Demonhound kramte gerade in einigen Akten, nahm eine heraus, drehte sich zu ihrem Bruder und erwiderte erzürnt: „Ich bin alt genug selbst zu entscheiden, also misch dich nicht in Dinge ein, die dich nichts angehen!“ „Ich will nur, dass dir nichts passiert.“ „Was sollte mir schon passieren?“ „Er versteht es, sich in unmöglichste und gefährlichste Situationen zu bringen, wie kein anderer. Außerdem ist er dir nicht gewachsen, du brauchst jemanden der sich auf deinem Niveau befindet.“ „Deswegen ist er wohl auch zum Verteidigungsminister ernannt worden. Oder ist gerade dies das Problem?“ „Was meinst du, Demonhound?“ „Du bist der oberste General des Phoenix-Programms hier und deswegen untersteht das Militär der Hadals eigentlich dir, aber er ist der Verteidigungsminister bei den Hadals und hier in dieser Allianz unterstehst du seinem Befehl und das stinkt dir.“ „Wir sind Profis und kommen zurecht.“ „Kommt ihr nicht, ihr seid Männer und in eurem Testosteronrausch verhaltet ihr euch wie bissig gewordene Hunde, die sich darum streiten wer die Markierung setzen darf.“ Demonhound legte die Akte auf ihren Schreibtisch und ging dann auf Azmodan zu. Dieser grübelte etwas und sagte dann: „Wie willst du das unseren Eltern erklären?“ „Was denn erklären? Das ist nur ein Date, mehr nicht, ich heirate ihn ja nicht gleich und jetzt verschwindest du. Ich bin schon überrascht, dass er mich eingeladen hat, trotz deiner Überreaktion letzten Monat, da soll nicht noch mal so etwas befürchten müssen, wenn er jeden Moment hier hereinspaziert.“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:14 
Wenige Sekunden später klopfte es an der Tür und nach einem routinierten „Herein“ von Demonhound, öffnete sich die Tür und Seisuke betrat das Büro. Er war schon fast bei Demonhound, als er endlich Azmodan bemerkte und stammelte: „G-General.“ Danach trat erst einmal ein langes Schweigen ein, dass erst durch ein weiteres Klopfen durchbrochen wurde. Wieder erschallte „Herein“, doch diesmal war es ein nervös aussehender Mitarbeiter des Außenministeriums. Demonhound fragte ihn: „Ist irgendetwas?“ Der Mann kam etwas näher und antwortete hektisch: „Ja, für General Azmodan und Minister Seisuke ist eine Nachricht eingetroffen.“ „Und wo ist sie?“ „Im Kommzentrum, dort wird sie gerade bearbeitet.“ „Na gut, dann gehen wir halt dorthin.“ Schlug Demonhound vor.

Das Kommunikationszentrum befand sich nur zwei Stockwerke unter Demonhound’s Büro und kaum war man dort angekommen, eilte der Mann zu einem Terminal, er rief eine Textdatei auf, die jedoch viele Lücken aufwies. Azmodan und Seisuke versuchten verzweifelt etwas aus dem Wirrwarr von Wörtern herauszufinden, gaben aber nicht ihr Scheitern zu. Schließlich äußerte Demonhound: „Männer, zu feige mal zu fragen. Was haben sie raus finden können?“ Azmodan und Seisuke wendeten sich von dem Bildschirm ab und dem Mann zu, als dieser berichtete: „Die Nachricht haben wir vor acht Tagen empfangen, doch sie war so sehr gestört, dass wir sie erst nicht zuordnen konnten. Also ließen wir einige Wiederherstellungsalgorithmen laufen und erfuhren so, dass die Nachricht an sie General und sie Herr Minister adressiert war. Das war gestern und eben konnten wir einige Inhalte herstellen. Die Nachricht stammt von Viruz, er lädt sie heute um 13 Uhr auf die unterste Etage der Tiefgarage unter dem Senat ein.“ Fast zeitgleich fragten Azmodan und Seisuke: „Warum?“ Und der Mann antwortete: „Leider ist die Nachricht nicht vollständig, aber ich möchte bemerken, dass wir es jetzt 12:45 Uhr haben.“ Azmodan sah auf seine Uhr und bestätigte die Zeit, dann sagte Seisuke zu Demonhound: „Ich glaube wir brauchen dafür nicht allzu lange, sagen wir halb eins hol ich dich in deinem Büro ab, dann können wir noch zum Italiener vor der Senatshalle gehen.“ „Okay. Aber komm nicht zu spät.“ Antwortete Demonhound darauf. Daraufhin rief Seisuke Horny und Bilbo an, damit sie ebenfalls um 13 Uhr in der Tiefgarage sein würden und schließlich verließen er und Azmodan das Außenministerium.



Die Tür öffnete sich und hinter einigen herumhuschenden Offizieren konnte man einen großen Bildschirm erkenne, der ein Raumschiff zeigte. Misel und Horizonte betraten die Brücke. Der Kapitän saß auf seinem Stuhl in der Mitte der Brücke und besprach etwas mit einem Mann neben ihm, dieser Mann kam Misel doch sehr bekannt vor und so begrüßte sie ihn: „Hey ho Nitro.“ Er wollte auch etwas sagen, doch dazu kam er nicht, als sie ihn schnell leicht drückte. „So nett warst du zu mir schon lange nicht mehr.“ Meckerte Horizonte. „Er hat mich ja auch nicht geschwängert, Strelo.“ Wetterte sie zurück. „Geschwängert?“ fragte Nitro verblüfft. „Ist ne lange Geschichte. Beim nächsten Briefing müssen werden wir wohl alle informieren müssen.“ Beantwortete Horizonte Nitro’s Frage. Horizonte ging zu dem Kapitän und Misel fragte Nitro: „Was machst du eigentlich hier?“ „Der Prätor wollte, dass ich das Enterkommando anführe.“ Erklärte Nitro. „Nenn ihn bloß nicht so oft Prätor, sonst kommt er sich noch wichtig vor.“ „Ich kann dich hören, Misel.“ Rief ihr Horizonte entgegen und wendete sich dann dem Kapitän zu: „Captain Hanson, wie ich sehe hat die Interceptor ihren Störgenerator bereits aktiviert.“ „Aye, kein Schiff im Umkreis von einer Million Kilometern kann ein stabiles Warpfeld aufbauen und in einigen Minuten fangen wir die Bre’ouri ab. Sie versuchen aus dem Störfeld zu gelangen, doch Captain Desoto bleibt mit der Interceptor dran.“ Entgegnete der Kapitän. „Was ist mit Capitan Diego?“ „Die Prometheus ist 200 Kilometer an Backbord und hält parallelen Kurs, Prätor.“ „Wissen sie Captain, wir sollten uns irgendwann mal für einheitliche Dienstgrade entscheiden. Damit es niemanden peinlich sein muss, wenn er mal nicht weis ob der Soldat, den er gerade anspricht Spanier, Brite oder Deutscher ist.“ „Schlagen sie das vor, Prätor, sie sind Ratsmitglied, nicht ich.“ „Werde ich, keine Sorge.“ Der Steuermann saß zwischen dem Kapitän und dem Bildschirm und dieser meldete gerade: „Captain, der Bre’ouri Transporter hat Schilde und Waffen aktiviert. Er hält direkten Kurs auf uns!“



„So Viruz, es ist jetzt 13:00 Uhr, dann tauch mal auf.“ Meckerte Seisuke, als er mit Horny, Azmodan und Don Bilbo in der Tiefgarage eintrafen. Horny schaute noch mal auf seine Uhr und wunderte sich, warum er denn so schwankte. Er überlegte kurz und dann fiel ihm auf, dass nicht er sondern die Garage schwankte. Das Schwanken wurde stärker und schneller bis es sich zu einem dröhnenden Vibrieren entwickelte. Plötzlich brach der Boden auf und eine Art maschineller Raupe mit Bohrkopf schnellte aus dem Loch hervor. Die Raupe fuhr ein paar Meter bis sie waagerecht stand, hielt an und eine Tür öffnete sich. Aus der Raupe sprang Viruz mit mehreren Bre’ouri Phasengewehren in der Hand und lief zu den anderen. „Was ist los Viruz?“ fragte Azmodan und Viruz antwortete: „Wie, habt ihr meine Nachricht denn bekommen? Ihr müsst sie erhalten haben, sonst wärt ihr ja nicht hier, also wisst ihr von dem Angriff.“ „Welcher Angriff? Deine Nachricht war beschädigt.“ „Ihr seid nicht auf einen Angriff mehrerer Bried-Horden vorbereitet?“ „Was sind Bried?“ fragte Don Bilbo. „Das sind die geklonten Wesen, welche das PAX zurzeit gegen seine Feinde einsetzt. Die nennen sich halt Bried. Wir sollten machen, dass wir hier rauskommen und die Verteidigung organisieren, denn von hier unten erreichen wir garantiert niemanden.“ Schlug Viruz vor und während sich die Gruppe zum Fahrstuhl begab, berichtete er weiter: „Heute früh hab ich ihr Waffenlager in die Luft gejagt, von da hab ich auch die Gewehre und nun sind sie alle unbewaffnet. Tja sie waren davon nicht so begeistert und deswegen folgten sie mir bis hierher. Die hätten sonst alle Städte der Hadals gleichzeitig angegriffen und so können wir sie hier bündeln. Ohne Waffen hätten sie keine Chance gegen unsere Truppen gehabt, wenn unsere Truppen denn vorbereitet gewesen wären, doch jetzt Gnade uns Gott!“ Es waren nur noch wenige Schritte zum Fahrstuhl, als das Schwanken wieder begann, zu einem Vibrieren wurde und der Boden aufbrach. Alle drehten sich zu der Aufbruchstelle um und Viruz murmelte nur noch: „Sie kommen.“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:14 
„Sie antworten noch immer nicht, Frau Außenministerin.“ Meldete der Kommunikationsoffizier. Misel stand neben ihm und drehte sich zu Horizonte, als dieser sagte: „Keine Zeit für Diplomatie.“ „Wir sollten es weiter versuchen.“ Erwiderte sie. „Das wird nichts bringen, die Bre’ouri sind dafür bekannt, ihre Geschäfte unter allen Umständen durchzusetzen.“ „Die werden doch nicht gegen eine Übermacht kämpfen wollen!“ „Sie sehen Kaufverträge als Heiligtum an und tatsächlich darf in ihrer Gesellschaft kein Vertrag, sei er noch so unbedeutend, gebrochen werden.“ „Wie wird das denn bestraft?“ „Ihnen wird die Handelslizenz entzogen und das bedeutet für sie den Tod!“ „Wenn du dir dabei so sicher warst, warum sollte ich dann mit?“ „Weil ich es eben nicht war, ich habe vorher gerade mal zwei Bre’ouri getroffen und die könnten Fanatiker gewesen sein, also war es wenigstens einen Versuch wert.“ Der Kapitän hatte mitgehört und entschied, dass es jetzt der richte Zeitpunkt war weitere Befehle zu geben: „Mr. Benner, fahren sie alle Generatoren auf volle Leistung hoch, auch die neuen. Laden sie die Waffen und den ganzen Rest in die Schilde.“, ohne den Kopf zu bewegen sagte er zu Horizonte: „Mal sehen, was die zusätzlichen Waffen und Schilde im Ernstfall bringen.“ Dann meldete der Waffenoffizier: „Waffen und Schilde sind geladen, der Transporter erreicht in 20 Sekunden unsere Waffenreichweite.“ „Gut, bereiten sie ihm eine volle Breitseite.“ „Aye, Sir.“ Bestätigte der Offizier.



Mehrere Bried strömten aus dem Loch, welches die zweite Raupe hinterlassen hatte. Sie rannten auf die Gruppe zu, die zwar den Fahrstuhlschacht erreicht hatte, aber noch auf die Kabine warten musste. Viruz wies sie an solange auf die Bried zu schießen, bis sie in den Fahrstuhl steigen konnten. Also feuerten sie blindlings, denn man konnte gar nichts verfehlen, so viele Feinde waren es. Als Don Bilbo einen Bried traf, sackte dieser zusammen und löste sich langsam in Luft auf. Viruz sah das und rief ihm zu: „Stell die Schussstärke bei deinem Gewehr runter, sonst geht dir die Energie aus!“ Bilbo folgte seinem Rat und ein paar Stufen niedriger ein. Jetzt wurden die Bried nicht mehr aufgelöst, sondern sackten nur noch zusammen oder wurden weg geschleudert. Dass man die Bried nicht auflöste hatte noch einen weiteren Vorteil, die Leichen der Toten behinderten die lebenden Bried dabei zu der Gruppe zu gelangen. Der Fahrstuhl kam endlich an und alle außer Viruz betraten sofort die Kabine, dieser wollte gerade auch hinein, als sein Gewehr den Geist aufgab. Er warf es mit den Worten ‚Scheiß Drecksding’ hin, zu den anderen rief er: „Fahrt ohne mich los, ich komme später nach. Oben organisiert ihr den Widerstand, denn es gibt bestimmt noch andere Plätze wo die durchgebrochen sind.“ Dann zog er zwei lange, leicht gebogene Messer und erwartete die anstürmenden Gegner. Bevor sich die Tür des Fahrstuhles komplett geschlossen hatte, konnten Horny und die anderen noch erkennen, wie Viruz mehrere Bried blitzschnell niedermetzelte.



„Sie nehmen uns unter Beschuss, Captain.“ Meldete der Waffenoffizier. „Dann feuern sie endlich zurück, Mr. Benner.“ Antwortete der Kapitän und blickte wieder nach vorn. Auf dem Bildschirm war eine große Menge von Torpedos zu erkennen, die auf die Pegasus zu flogen und auf dem unteren Rand wurden kurz danach die Torpedos der Pegasus und der Prometheus dargestellt, welche sich dem Transporter näherten. Dem Steuermann befahl er: „Mr. Donnahey, hart steuerbord, versuchen sie den Torpedos auszuweichen. Der Rest auf Aufschlag bereitmachen!“ „Was heißt das, Strelo?“ fragte Misel und Horizonte antwortete ihr: „Halt dich irgendwo gut fest!“ Dann schlugen die Torpedos des Bre’ouri Schiffes ein. Die Pegasus wurde stark durchgeschüttelt und die Konsole vor einem technischen Offizier auf der Brücke explodierte. Die Druckwelle schleuderte ihn zurück, bis zu einem Geländer, an dem er schließlich abgebremst wurde. Der Kapitän reagierte sofort, drückte einen Knopf und sagte: „Sanitäter auf die Brücke.“ Danach widmete er sich dem Waffenoffizier: „Status!“ Der Offizier berichtete: „Keine größeren Schäden an der Hülle, einige durchgebrannte Relais. Die primären Schilde sind zusammengebrochen, die sekundären halten.“ „Bringen sie uns näher heran, Mr. Donnahey!“ Der Kapitän drehte sich zu Horizonte und Misel um und fragte: „Wer hatte eigentlich die Idee mit den sekundären Schilden?“ „General Marco, als er mit General Azmodan den Verteidigungsplan aufstellte.“ Antwortete Horizonte. „Dann muss ich wohl General Marco einen Kasten Bier ausgeben, ohne diese Schilde wären wir jetzt alle atomisiert worden!“ „Ja danke, dass ich in meinem Zustand hier sein darf, wär’ ich doch bloß auf dem Planeten geblieben, da ist es wenigstens sicher.“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:15 
Viruz kämpfte sich zu einer Treppe durch. Er war überall mit dem Blut dutzender getöteter Bried beschmiert und einige eigene Wunden leisteten auch ihren Beitrag zu dem äußerst brutalen Bild, dass er hier hinterließ. Ein Stockwerk höher konnte er eine schwere Tür schließen, doch bevor sie ganz zu war, warf er noch einen Sprengsatz den hinterher stürmenden Bried entgegen.



Der Fahrstuhl hatte angehalten und die Gruppe ihn verlassen. Dann fragte Horny: „Sollen wir auf Viruz warten?“ Azmodan beantwortete die Frage: „Nein, er wollte, dass wir die Verteidigung sofort organisieren.“ Er holte eine Art Handy heraus, wählte eine Nummer und sagte dann: „Ja, wissen wir bereits. ----- Was? Okay, Horny und Don Bilbo stoßen zu euch, Seisuke und ich werden später zu euch stoßen.“ Dann legte er auf und berichtete: „Nikitaman und Future sind im Kommandobunker und organisieren bereits die Verteidigung. Horny, Bilbo, ihr helft ihnen. Seisuke und ich werden Demonhound aus dem Außenministerium holen.“ Horny und Bilbo liefen los. Seisuke rannte hinter Azmodan her und fragte: „Was ist denn mit Demonhound los?“ „Nikitaman kann seit einigen Minuten niemanden im Außenministerium mehr erreichen.“



„Wir haben optimale Waffenreichweite erreicht, Sir.“ Berichtete der Waffenoffizier und der Kapitän antwortete: „Feuer frei!“ Der Steuermann meldete kurz darauf: „Der Transporter dreht ab und hält auf die Interceptor zu.“ „Er will den Störgenerator ausschalten. Nachricht an die Interceptor, sie soll Abstand halten!“ „Aye, Sir.“ Bestätigte der Kommunikationsoffizier. „Wie sieht es eigentlich bei den Bre’ouri Schilden aus?“ „Die Bugschilde sind bei 57 Prozent, die am Heck bei 41.“ Antwortete der Waffenoffizier. „Teilen sie der Prometheus mit, weiter auf das Heck zu feuern, wenn die Schilde durchbrochen sind, dann muss der Hauptgenerator ausgeschaltet werden.“ Der Kapitän sah wieder auf den Hauptbildschirm und sagte: „Jetzt haben wir dich!“



Azmodan und Seisuke gingen durch den Eingangsbereich des Außenministeriums, nirgends war jemand zu sehen. Entweder waren alle Lampen defekt oder der Strom war ausgefallen, jedenfalls war die Atmosphäre gruseliger als es sich Seisuke je gewünscht hätte. Sie entschieden sich nicht den Fahrstuhl zu verwenden, also eilten sie die Treppe hoch in den sechsten Stock. Immer noch waren sie auf niemanden getroffen und mit jedem Schritt auf Demonhound’s Büro vergrößerten sich ihre Sorgen. Die Tür stand offen und Azmodan wollte schon herein, als aus einem anderen Büro zwei Bried stürmten. Azmodan stand in Seisukes Schussweg und der General selbst konnte nur einen von ihnen erschießen. Der andere Bried schlug Azmodan die Waffe aus der Hand und holte gerade aus um nun ihn zu töten, da erwischte ihn offen bar ein geworfenes Messer am Kopf. Mit dem Kopf stieß der Bried an die der Bürotür gegenüberliegenden Wand und brach da tot zusammen. Azmodan vergewisserte sich und sah genau nach. Es steckte tatsächlich so etwas wie ein Messer in der Schläfe des Bried. Danach drehte er sich um und sah im Büro Demonhound stehen. Er und Seisuke betraten das Büro und nachdem er seine Schwester umarmt hatte, fragte er sie: „Was hast du da eigentlich geworfen?“ „Ach, das war mein Brieföffner.“



Eine große Explosion kündigte das Ende des Hauptgenerators des Bre’ouri Schiffes an. „Captain, der Transporter hat seine Hauptenergie verloren. Seine Schilde, Waffen und der Antrieb sind ausgefallen.“ Äußerte der Waffenoffizier. Horizonte trat zu Nitro und sagte: „Jetzt bist du dran, viel Glück.“ Nitro nickte und verließ die Brücke. Dann befahl der Kapitän: „Die Prometheus soll uns Deckung geben, wir docken an.“



Marco und Bilbo waren seit einigen Minuten im Kommandobunker und unterstützten Nikitaman und Future. Marco fragte Nikitaman: „Welche Truppenteile konnten wir bereits mobilisieren?“ „Nur die Bereitschaftspolizei und die Prätorianergarde. Das Militär braucht noch etwas.“ Antwortete Nikitaman. Daraufhin mischte sich Future ein: „Wenn die hier auftauchen, dass haben wir endlich die Chance das hier unter Kontrolle zu bringen.“ „Wenn wir dann noch leben.“ Warf Bilbo ein und sah auf einen großen Monitor, der einen Lageplan der Stadt aufwies. Blau gefärbt waren die Stadtteile die man kontrollierte, die roten standen für die Teile, die man an die Bried verloren hatte, oder über die man nicht bescheid wusste, weil sich von dort niemand meldete und zurzeit dominierte rot.



Nitro und einige andere PSF-Mitglieder bewegten sich durch einen Gang zur Brücke des Transporters hin. Sie waren bisher auf keinen nennenswerten Widerstand gestoßen, doch jetzt näherte man sich dem Gehirn des Schiffes und das würden die Bre’ouri sicherlich nicht kampflos aufgeben. Dies wurde Nitro schneller bewusst als er es geahnt hätte. Drei Bre’ouri hatten sich am Eingang zur Brücke verschanzt und nahmen nun die Menschen unter Feuer. Hinter einigen im Gang stehenden Kisten suchte Nitro Deckung. Dann spähte er kurz raus und zog den Kopf gleich wieder ein. Er merkte sich ihre Positionen, verließ kurz seine Deckung, zielte, schoss und traf einen von ihnen. Dann huschte er wieder zurück hinter die Kisten. Er sah die anderen Soldaten an und sagte: „Betäubung klappt schon mal!“ Das Spiel mit dem Deckung verlassen wiederholte sich noch zweimal, dann konnte Nitro endlich die Brücke einnehmen. Die Bre’ouri-Brückencrew hatte sich ergeben und Nitro meldete an die Pegasus: „Die Brücke und der Rest des Schiffes ist unter unserer Kontrolle.“ „Verstanden. Beginnen jetzt mit dem Verladen der Fracht. Pegasus ende.“



Viruz betrat den Kommandobunker, sah Marco und fragte: „Wie sieht es in der Stadt aus?“ Marco drehte sich zu Viruz und war von dessen Anblick mehr als nur geschockt: „Was, wie, was ist eigentlich mit dir passiert?“ Viruz sah zu Boden und bemerkte, dass er überall das Briedblut hinterließ, dann blickte er wieder zu Marco und antwortete: „Ist ne lange Geschichte. Wo sind Seisuke und General Azmodan?“ „Die sind genau hinter dir.“ Rief Azmodan, der mit Seisuke und Demonhound gerade den Kommandobunker betrat, Viruz zu. Seisuke ging näher an Viruz heran und fragte: „Was ist das da auf deiner Schulter?“ Viruz nahm etwas pechschwarzes, das an seiner Schulter klebte, in die Hand und sagte: „Wahrscheinlich Briedleber oder Milz.“ Azmodan hingegen sah auf den Bildschirm und fragte: „So langsam nimmt die Stadt wieder blaue Züge an.“ „Stimmt, die Armee maschiert auf breiter Front von Richtung Norden ein, die machen diese Bastarde fertig.“ Erklärte Future und Nikitaman setzte fort: „In einer Stunde haben wir die gesamte Stadt wieder unter Kontrolle und dann wird der wirklich schmutzige Teil dieses Angriffes anfangen, die Bergung der Toten.“



„Sir, die Fracht und die PSF-Teams sind an Bord.“ Meldete der Kommunikationsoffizier. „Dann docken sie ab und bringen sie uns so schnell möglich von dem Transporter weg.“ Befahl der Kapitän dem Steuermann.

Nitro betrat die Brücke, ging zu Misel und Horizonte und zeigte ihnen ein großes, schweres Gerät. Horizonte fragte: „Was ist das?“ „Das ist ein tragbarer Neutronensequenzer, damit kann ein geübter Schütze einen Ravanger vom Himmel holen.“ Antwortete Nitro und Misel sagte besorgt: „Die hatten da was ganz Großes vor und wahrscheinlich werden sie nicht einfach so aufgeben.“

Ein Blitz lenkte die Aufmerksamkeit aller Anwesenden auf den Hauptschirm. Gefolgt wurde der Blitz von einer kleinen Erschütterung und Misel erkannte, dass gerade das Bre’ouri Frachtschiff explodiert war. Sie war schockiert und fragte Horizonte: „Warum habt ihr es denn zerstört.“ „Das waren nicht wir, die haben die Selbstzerstörung aktiviert.“ Antwortete dieser. „Warum denn nur?“ „Weil sie ihren Kaufvertrag nicht mehr einhalten konnten und sie deswegen sowieso tot waren, sie haben nur den schnelleren Weg gewählt.“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:16 
Antipathie



Der Schein der Sonne wärmte Seevi sehr angenehm, doch wenn er die Augen öffnete, blendete ihn derselbige. Es gab nur eine Lösung für dieses Problem, also setzte er seine Sonnenbrille auf und lies seinen Blick über das vor ihm liegende Tal gleiten. Der kleine Fluss, der dieses Tal einst schuf und noch immer vergrößerte, floss ruhig dahin und die Ufer waren gesäumt von Laubbäumen verschiedenster Arten.

„Kommissar? Kommen sie, es ist da drüben.“ Rief Christoph Bäumer, Seevi’s neuer Partner ihm zu. Er war ihm nach Bristot’s Tod zugeteilt worden und eigentlich sollte er sein Partner sein, doch er war so unerfahren, dass er Seevi eher wie ein Schüler vorkam. Seevi folgte ihm und blieb, als er einen kleinen Hang hinab lief, an einem am Boden liegenden Ast, hängen. Nur mit Mühe konnte er einen Sturz verhindern und fluchte dann: „Ach Mist verdammter.“ „Kommissar?“ fragte Bäumer. „Es ist nichts, nur ein Ast hat im Weg gelegen.“ Antwortete Seevi. Ein Mann in einem weißen Kittel kam ihnen entgegen und setzte seinen Weg unbeeindruckt fort. Auch Seevi und Bäumer gingen weiter bis sie ihr Ziel erreichten.

„Was haben wir hier, Carter?“ fragte Seevi einen Mann, der wie der andere einen weißen Kittel trug. „Einen männlichen Weißen, zwischen 30 und 35 Jahren. Er hat eine Plasmaschusswunde in der Brust.“ Antwortete dieser. Seevi kam etwas näher und betrachtete den Kopf des Toten. „Was ist mit seinem Gesicht passiert?“ „Krähen, sie haben ihm zuerst die Augen aus den Höhlen gefressen und dann sind sie über den Rest seiner unbedeckten Haut hergefallen.“ „Können sie sagen wie lange der Mord her ist?“ „Wir wissen doch noch gar nicht, ob es ein Mord ist.“ „Wie lange ist die Tötung her?“ „Genau kann ich das noch nicht sagen.“ „Mir reicht auch ein Schätzwert.“ „Na gut, ich denke so etwa eine Woche.“ Seevi trat etwas weiter weg und beobachtete den Schauplatz aus einer anderen Position. Schließlich sagte er: „Er ist nicht hier getötet worden.“ „Woher wollen sie das wissen?“ fragte Bäumer. „Sehen sie die Schlammreste um die Leiche, vor ein paar Tagen hat es ziemlich geschüttet, wahrscheinlich ist er wesentlich weiter Flussaufwärts getötet worden. Wir sind hier also fertig, ihr könnt die Leiche zur Autopsie bringen.“ „Flussaufwärts liegen Ankh Morpork und Vorgon City, das ist Hadals-Land!“ „Ich weis, aber wir müssen hin, denn dort wartet die Wahrheit!“



„War sicherlich ganz hübsch, zumindest bevor ihn die Krähen erwischt haben.“, meinte Carter, „Doch jetzt ist er ein Fall für ne Singlebörse.“ „Das ist nicht witzig.“ Wies ihn Bäumer zurecht. „Oh, alles ist witzig, es hängt nur von dem Humor der Person ab!“ entgegnete Carter.

Seevi betrachtete wortlos das Geschehen. Nachdem man die Leiche verladen hatte, brachte man sie in die Pathologie, damit man sie dort genauer untersuchen konnte. Bisher hatte Carter ihr den Brustkorb geöffnet und war nun dabei die Schusswunde zu analysieren. „Wie ich es mir gedacht hatte – ein Plasma-Projektil. Es trat zwischen zwei Rippen ein, punktierte den rechten Lungenflügel und blieb dann in der Wirbelsäule stecken. Das Plasma hat alles bis zum Rückenmark versengt. Aufgrund der Zersetzung der inneren, unbeschädigten Organe kann ich denn Todeszeitpunkt auf den späten Nachmittag des letzten Sonntags festsetzen. Wissen sie was das hier ist, Bäumer?“ Carter holte eine geleeartige Masse aus der Leiche heraus und zeigte sie Bäumer. Dieser antwortete: „Nein, was ist das?“ „In Körpersäften gedünstete Lunge.“ Darauf rannte Bäumer würgend auf die Toilette.

„Müssen sie ihn immer so fertig machen, Carter?“ tadelte Seevi ihn. „Wenn er das hier nicht aushält, dann sollte er nicht hier rum stehen, er könnte zumindest Katrin bei der DNS-Analyse helfen, damit wir endlich wissen um wen es sich hier handelt.“ Beschwerte sich Carter. „Wie weit ist sie eigentlich?“ „Müsste eigentlich jeden Moment fertig sein.“ Eine Frau kam gerade in die Pathologie. „Ah, wenn man vom Teufel spricht.“ Sagte Carter und zog sich die Handschuhe aus. „Eigentlich betrachte ich mich eher als heiße Domina, aber nenn mich wie es dir gefällt.“ Erwiderte Katrin Wiegand, seit zwei Jahren pathologische Assistentin von Ernest Carter, und überreichte ihm einen Computerausdruck. Carter sah sich das Blatt an und überreichte es Seevi. Dieser konnte nicht glauben was darauf stand. Bäumer kam endlich wieder von der Toilette, er sah übel aus, doch irgendwie wirkte Seevi noch maroder als er selbst, also fragte er ihn: „Was ist los, Kommissar?“ Seevi übergab ihm das Blatt und sagte dann: „Ich kannte den Mann, er war bei der Light Company.“ Bäumer las sich das Blatt durch und meinte: „Seltsamer Name: LordxRaven.“



Mittlerweile wurde es dunkel und die Straßenbeleuchtung in Vorgon City wurde eingeschaltet. Demonhound und Seisuke kamen gerade von einer Besprechung und unterhielten sich. „Weist du, wir sollten mal das Essen nachholen, das wir wegen des Angriffs haben ausfallen müssen.“ Schlug Seisuke vor und Demonhound antwortete: „Vielleicht.“ „Was heißt denn vielleicht?“ „Es war einfach zu viel los und es ist noch zu viel los. Die Trümmer sind kaum weggeschafft und im Außenministerium ist seitdem die Hölle los. Ich hab einfach etwas zu viel Stress.“ „Am besten baut man den beim Essen ab.“ „Du bist süß, aber da ist noch was.“ „Was denn?“ „Meine Chefin.“ „Misel?“ „Ja, seit sie mit Prätor Horizonte zugegeben hat, nun ja, dass sie schwanger ist und dann war da noch diese Messiasgeschichte.“ „Und?“ „Ich hab einfach Angst, dass es mir auch so schnell passiert.“ „Die waren nie essen, die haben gleich gesoffen.“ Sie kamen an eine Kreuzung und blieben stehen. Seisuke sah Demonhound an und sagte: „Wir sollten uns nicht von den beiden beeinflussen lassen, komm du kennst sie, die sind verrückt, die haben beide Mathe studiert, das macht doch kein normaler Mensch.“ „Richtig, was meinst du schlafen sie noch mit einander?“ „Heute Morgen hab ich Misel zur Ministerkonferenz abgeholt und war bei denen in der Wohnung, die haben getrennte Schlafzimmer.“ „Das heißt nicht, dass sie es nicht mehr miteinander treiben!“ „Stimmt, aber seltsam wäre es schon.“ „Das sind Mathematiker!“ „Okay, das erklärt alles.“ Ein Auto fuhr sehr schnell an ihnen vorbei und hielt etwa 150 Meter entfernt vor dem Senatsgebäude an. „Das ist merkwürdig.“ Sagte Seisuke und Demonhound fragte: „Was ist merkwürdig?“ „Normalerweise ist es zu spät, der Senat hat längst geschlossen. Das ist irgendwas im Busch und wenn es so ist, sollten wir wissen worum es geht!“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:17 
„Muss ich das wirklich machen?“ fragte Horizonte und Misel antwortete barsch: „Ja!“ „Warum denn?“ „Du hast es rein gebracht, dann holst du es auch wieder raus!“ Die anderen Anwesenden blickten beide eher ungläubig an und kümmerten sich schnell wieder um sich selbst. Es waren außer Misel und Horizonte noch 3 weitere Paare in dem Raum, eine Frau schien hoch schwanger zu sein. „Weist du, ich hab eigentlich viel zu tun und kann es mir nicht leisten hier Zeit zu verschwenden.“ Meckerte Horizonte. Misel saß neben ihm auf einer weichen Matte und drehte sich zu ihm. Sie schrie ihn an: „Aber Zeit mich abzufüllen und zu vögeln hattest du?“ „Ist ja schon gut, ich mach mit.“ Versuchte Horizonte sie zu besänftigen. Die anderen Paare widmeten wieder den beiden ihre ganze Aufmerksamkeit, dies missfiel Horizonte: „Haben sie nichts anderes zu tun, als bei unseren Privatgesprächen zu lauschen und wenn sie sich das fragen, anders als in der Lautstärke kenn ich sie gar nicht.“ Das nächste was Horizonte fühlte, war Misel’s Ellenbogen in seinen Rippen.

Die Tür ging auf und ein weiteres Paar betrat den Raum und setzte sich so, dass alle Paare einen Kreis bildeten. Die Frau begann zu sprechen: „Wir, das heißt mein Verlobter Payne und ich, Speedy2, heißen sie hiermit zu unserem allwöchentlichen Schwangerschafts- und Geburtsvorbereitungskurs willkommen.“ Alle bis auf Horizonte grüßten sie zurück. Ihm kam die ganze Versammlung wie ein Treffen der anonymen Alkoholiker oder zumindest wie ein Pfadfinderclub für Geistigzurückgebliebene vor. Die Leute, die hier zurückgrüßten, waren auch die Menschen, die im Flugzeug am lautesten klatschten, wenn es gelandet war.

Speedy2 eröffnete die erste Stunde: „Heute wollen wir das richtige Liegen und die richtige Atmung bei der Geburt üben. Also würden bitte alle Damen sich so hinlegen, dass ihre Beine in die Mitte des Kreises zeigen, sie diese anwinkeln und ihren Kopf in den Schoß ihres Partners legen?“ Als hätten sie jahrelang Synchrontanzen betrieben, folgten alle vier Frauen den Anweisungen von Speedy2, die dies selbst mit Payne machte. Misel legte ihren Kopf auf Horizontes Schoß und er genoss den leichten Druck den dieser auf seinen Schritt ausübte. Dies leitete ihn zu der folgender Äußerung hin: „War vielleicht doch keine so schlechte Idee hierher zu kommen.“ „Sei bloß still!“ fauchte ihn Misel an.

Nachdem alle die richtige Position gefunden hatten, sagte Payne: „Nun fangen wir mit den Atemübungen an. Holen sie alle tief Luft und lassen sie sie langsam und gleichmäßig entweichen. Die Herren können ebenfalls mitmachen um ihre Partnerinnen zu unterstützen.“ Um einen Streit mit Misel aus dem Weg zu gehen, machte Horizonte diesmal bereitwillig mit. Ein an einen defekten Staubsauger erinnerndes Geräusch begleitete das gleichzeitige Ein- und Ausatmen. Danach merkte Speedy2 an: „Denken sie immer daran, bei der Geburt müssen sie gleichmäßig, ausdauernd und ruhig atmen. Wenn sie zu schnell werden, könnten sie Hyperventilieren und dann riskieren sie ihr eigenes Leben und das des Kindes! Die Atmung eben war aber perfekt, Gratulation, sie sind alle talentierte werdende Mütter und natürlich auch Väter.“ Ohne eine Sekunde Unterbrechung setzte Payne Speedy2’s Worte fort: „Und jetzt wollen wir diese Übung zweimal wiederholen und danach zu weiteren Atmungstechniken kommen.“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:17 
Plötzlich vibrierte Horizontes Handy in seiner Hosentasche, doch so wie er jetzt saß und Misels Kopf auf seinem Schoß lag, kam er nicht ran. Er versuchte sich irgendwie zu verdrehen und so mit der Hand ran zukommen, doch es gelang ihm nicht, also wurde er etwas ruppiger und schließlich kam er dran. Doch gleichzeitig rutschte Misels Kopf von seinem Schoß und schlug etwas unangenehm auf der Matte auf. Sie beschwerte sich: „Was soll das, Strelo?“ „Moment.“ Antwortete er und nahm den Anruf an. Er sagte nicht viel, außer am ende des Gesprächs: „Okay, wir kommen sofort.“ „Wohin sollen wir?“ fragte Misel. „In den Senat, Kommissar Seevi wartet dort auf uns.“ „Wieso?“ „Keine Ahnung, muss aber irgendwas wichtiges sein.“ Beide standen auf und verließen schnell und wortlos den Raum.

Ein Mann sagte darauf: „Endlich! Man, können die nerven!“ Speedy2 schlug vor: „Wir sollten jetzt wieder mit der Übung fortfahren. Also alle bitte jetzt wieder ruhig und tief einatmen.“



Horizonte lief mit Misel den Gang zum Senat entlang, während Misel etwas einfiel: „Wir sollten diese Stunde unbedingt nachholen!“ „Da sehe ich kein Problem, wir könnten nach dieser Sache hier, bei Speedy2 und Payne vorbeischauen.“ Erwiderte Horizonte. „Du weist wo sie wohnen?“ „Ich lese die Geheimdienstakten über alle Personen mit denen ich etwas zu tun haben könnte. Das ist besser bei dem was wir tun!“ „Ein Kind bekommen?“ „Nein ich mein den Phoenix.“ „Ach so, um was geht es denn überhaupt?“ „Das hat Seisuke nicht erwähnt, aber dass Seevi hier ist und uns unbedingt sprechen will.“ „Seevi, der Kommissar aus Tharkad?“ „Genau der Kerl, dem General Azmodan das Gedächtnis hat löschen lassen.“

Mittlerweile hatten sie den Eingang zur Senatshalle erreicht, darin waren bereits Azmodan, Don Bilbo, Horny, Seisuke und Demonhound anwesend. Seevi und Bäumer standen etwas abseits und unterhielten sich, bis sie Horizonte und Misel bemerkten, die gerade die Halle betraten. „Wunderbar, dann können wir ja endlich anfangen.“, rief Seevi allen Anwesenden entgegen, „Für alle die mich nicht kennen, ich bin Kommissar Seevi und dies ist mein Assistent Bäumer. Wir sind hier um ihnen einige Fragen zu stellen. Die Befragung wird einzeln vorgenommen werden. Fragen?“ Seisuke stellte die Frage, die sich alle fragten: „Was ist passiert, dass sie uns befragen wollen?“ „Vor acht Stunden hat ein Wanderer in Tharkad eine Leiche gefunden. Es handelte sich dabei um einen Mann, der hier auf Hadals-Territorium ermordet wurde. Diesen Mann kannten sie alle, es war LordxRaven!“

Eine tiefe Bestürzung machte sich breit, jeder dachte sofort über ihn und die gemeinsam erlebten Momente nach. Horny löste sich als erster und fragte: „Was können sie uns über die Umstände seines Todes erzählen?“ „Nichts, dafür sind die Befragungen ja da.“ Erklärte Seevi. Er lies einige Minuten verstreichen bis er sagte: „Ich muss sie jetzt bitten sich zu trennen, sie bleiben hier in diesem Saal, aber von einander getrennt, mein Assistent wird sie im Auge behalten. Ich bitte dann jeden einzeln in den Nebenraum und wir fangen mit ihnen Azmodan an.“



Der Nebenraum war eine kleine Abstellkammer für allerlei Technikgerätschaften wie Beamer und Ersatzlautsprecher. Seevi hatte einen Tisch und einen Stuhl aufgestellt, auf den sich der Befragte dann setzen sollte. Das war eine alte Verhörtechnik, er kam dadurch seinem Gegenüber viel größer und mächtiger vor und kam so leichter an die Wahrheit ran.

Horny setzte sich und Seevi begann auch gleich: „Wo waren sie am letzten Sonntag?“ „Da war ich in meiner Stadt NicePlace und habe mich mit einem Haufen Verwaltungskram beschäftigt.“ Antwortete Horny. „Hatte er irgendwelche Feinde?“ „Nein, soweit ich weis nicht, aber das muss nichts heißen, wir haben in den letzten Monaten uns viele Feinde gemacht.“ „Sie sind mit anderen aus der Light Company ausgetreten, warum?“ „Wir fühlten uns dort nicht mehr besonders bestätigt.“ „Aha, danke, sagen sie Demonhound dass ich sie jetzt sprechen möchte.“

Horny verlies den Raum, ging zu Demonhound und sagte ihr Bescheid. Sie betrat dann den Raum und sagte: „Ich wollte ihnen nur mitteilen, dass ich LordxRaven gar nicht kannte.“ „Das macht nichts, haben sie irgendetwas mitbekommen, ob über ihn geredet wurde, ob er mal erwähnt wurde oder so in der Art?“ „Nein, nicht dass ich wüsste.“ „Wo waren sie am letzten Sonntag?“ „Da hab ich Misel im Außenministerium vertreten, als mit Horizonte gearbeitet hat.“ „Kann das jemand bestätigen?“ „Dass ich Misel vertreten habe oder dass Misel und Horizonte zusammen waren?“ „Ersteres.“ „Eine Menge Mitarbeiter im Außenministerium haben mich damals dort gesehen. Sicherlich werden sich einige finden lassen.“ „Na gut, wenn sie rausgehen, bitten sie Azmodan herein.“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:18 
„Wo waren sie am letzten Sonntag?“ fragte Seevi und Azmodan antwortete: „Da war ich mit Don Bilbo beim Angeln.“ „Angeln?“ „Ja, Angeln, hier braucht man kaum die Angel auszuwerfen um einen Fisch zu fangen.“ „Dann brauch ich Don Bilbo wohl gar nicht mehr zu fragen.“ „Ach der Don redet gern mit ihnen.“ „Raus!“



„Wo waren sie am letzten Sonntag?“ fragte Seevi diesmal schon von der Frage genervt. Seisuke saß ihm entspannt gegenüber und antwortete: „Da war ich den ganzen Tag lang an der Nordwand des Eyron-Berges Klettern.“ „Gibt es jemanden, der das bestätigen kann?“ „Ungefähr zwei dutzend Menschen, die auch an dem Tag an dieser Wand geklettert sind.“



„Sie waren also mit Horizonte an diesem Tag zusammen?“ fragte Seevi und Misel antwortete ruppig: „Ja, das hab ich doch gesagt oder?“ „Haben sie, ich wollte doch nur sicher gehen, darf ich denn fragen, was sie getan haben?“ „Wir haben uns um die Folgen des Angriffs vor zwei Wochen gekümmert, versuchten raus zu finden, wer ihn befohlen hat.“ „Und haben sie was heraus gefunden?“ „Nein, leider nicht, war es das jetzt?“ „Ja, danke, schicken sie mir Horizonte rein.“

Horizonte hatte Platz genommen und Seevi sagte darauf: „Ich habe auf der Fahrt hierher einiges an Schäden gesehen. Es tut mir leid, was vor zwei Wochen passiert ist. Viele Tote?“ „437 Zivilisten, 113 Soldaten der Armee, 82 Polizisten und 39 Prätorianer.“ „Sie können sich an diese Zahlen so genau erinnern?“ „Solche Zahlen vergisst man nicht.“ „Stimmt, das beweist mir auch, dass sie und Misel am letzten Sonntag zusammen sich um diese Dinge gekümmert haben. Damit wäre ich erst einmal mit ihnen allen durch.“ „Ich hätte eine Frage.“ „Ja?“ „Wieso können sie eigentlich einfach so Ermittlungen außerhalb der Light Company betreiben? Schließlich wurde unser Bündnis gekündigt.“ „Ich habe mich genau informiert, sie haben das militärische Bündnis gekündigt, aber nicht die zivilen Verträge und unter denen befindet sich ein Abkommen über die überregionale Verbrechensbekämpfung.“ „Ich glaub ich muss Misel mal an diese Verträge setzen.“ Horizonte stand auf und verließ mit Seevi den Raum. Seevi und Bäumer fuhren wieder nach Tharkad, während die Hadals in der Halle zurückblieben und versuchten die letzten Ereignisse zu verarbeiten.



Die Tür zu LordxRavens Wohnung war mit der Hilfe des Hausmeisters geöffnet worden und Spurensicherungsteams der Polizei durchsuchten die Wohnung gerade, als Seevi mit einem Becher Kaffee in der Hand durch die geöffnete Tür eintrat. Bäumer sah ihn und näherte sich ihm schnell. Er hielt ihm eine Brieftasche unter die Nase: „Darin sind Pass, Personalausweis und andere Dokumente. Alles was wir bei der Leiche vermisst haben. Könnte es etwas bedeuten?“ „Vielleicht, aber nicht unbedingt, dennoch sollten wir das im Auge behalten.“ Erwiderte Seevi und nahm dann einen Schluck des heißen Kaffees. Ein Beamter hob einen Zettel auf, ging dann zum Kommissar und meldete: „Dieses Blatt haben wir in einer Schublade gefunden, sie sollten lesen was draufsteht.“ Seevi nahm das Blatt in seine freie linke Hand, las es und sagte: „Das ist eine Einladung, zum letzten Sonntag, 14:00 Uhr in Ankh Morpork. Man muss kein Genie sein um zu erraten, dass er dort ermordet wurde und dass diese Einladung vom Mörder geschrieben wurde. Gibt es irgendwelche Fingerabdrücke oder Zellmaterial darauf?“ „Nein, Kommissar, wir haben nur die Fingerabdrücke vom Opfer gefunden.“ Seevi gab das Blatt zurück und trank einen weiteren Schluck des Kaffees. Nachdem der Beamte sich wieder an seine Arbeit gemacht hatte, fragte Bäumer: „Und was denken sie?“ Seevi blickte direkt in einen Spiegel und betrachtete sein Spiegelbild, als er antwortete: „Ich denke, wir sollten Misel genauer überprüfen.“ „Aber sie war doch gar nicht in Ankh Morpork.“ „Das ist nicht besonders weit von Vorgon City und wahrscheinlich hätte sie tatsächlich diesen Mord nicht selbst ausgeführt, aber sie hat ihn vielleicht in Auftrag gegeben!“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:18 
„Bei allem Respekt, aber sie sind das merkwürdigste Paar, das ich bisher getroffen habe!“, äußerte sich Payne, „Also, wenn ich das richtig verstanden habe, hatten sie beide zuviel getrunken und offenbar danach ein Kind gezeugt. Dann sind sie, Misel, bei Strelo eingezogen, weil ihnen ihre Wohnung zu klein war.“ „Das ist richtig, mein Bruder war zu der Zeit auch gerade von der Erde hierher gekommen und so war sie wirklich zu klein geworden.“ Erklärte Misel. Payne saß auf einen Sessel, während Speedy2 bei Misel und Horizonte auf dem Sofa in Payne’s Wohnung Platz genommen hatte. Es war mittlerweile Nachmittag und die Sonnen fluteten durch mehrere Fenster das Wohnzimmer mit ihrem warmen Licht. Horizonte stellte die alles entscheidende Frage: „Können wir nun die Stunde gestern wiederholen?“ „Sicherlich, gegen eine kleine Zusatzgebühr!“ antwortete Payne prompt. Horizonte sah zu Misel und sagte: „Du willst sicher, dass ich die bezahle.“ Misel nickte nur und Horizonte setzte fort: „War ja klar. Das Geld ist noch heute auf ihrem Konto, Payne.“ „Sehr schön, dann schlage ich morgen Nachmittag vor und versuchen sie die nächsten Sitzungen möglichst einzuhalten!“ ermahnte Speedy2.



In der Abteilung für Kapitalverbrechen, recherchierte Bäumer gerade am Computer, als Seevi hinter ihm, wie üblich mit einem Kaffee in der Hand, auftauchte und ihn halb zu tote erschreckte. Dann fragte der über seinen gelungenen Auftritt amüsierte Seevi: „Was haben sie über Misel raus gefunden?“ „Nicht viel, sie ist aber vor einem Monat umgezogen.“ Antwortete Bäumer, der sich vom Bildschirm nur schwer trennen konnte. „Wohin?“ „Zu Horizonte.“ Seevi nahm einen Schluck Kaffee und dachte nach, immer wenn er das machte sagte er mehr beiläufig: „Interessant.“ „Mehr hab ich nicht rausbekommen, ist aber auch nicht mein Spezialgebiet. Deswegen hab ich auch Tanja auf die Sache angesetzt, vielleicht weis sie schon mehr über Misel.“ Teilte ihm Bäumer mit. Ohne weitere Worte zu verschwenden gingen Seevi und Bäumer quer durch den Raum zu Tanja Kronberg’s Arbeitsplatz. Sie war gerade dabei einige Dokumente zu speichern, als Seevi fragte: „Haben sie etwas über Misel?“ „Ja, sie ist schwanger!“ antwortete Tanja. „Haben sie ihre Krankenakte?“ „Nein, an die kommen wir nicht ran, solange sie keine Hauptverdächtige ist.“ „Zurzeit ist sie unsere einzige Verdächtige.“ „Aber nicht vom Staatsanwalt bestätigt. Nein ich hab einfach eins und eins zusammen gezählt.“ „Und was?“ „Sie besorgt sich drei Jahren regelmäßig in derselben Apotheke ihre Antibabypille und Tampons, also was sagt und das?“ „Das sie es aufgegeben hat einen Mann zu finden?“ „Das würde nicht die Tampons erklären.“ „Wechseljahre?“ „Dafür ist sie noch zu jung, nein sie kann nicht mehr schwanger werden und hat keine Menstruation mehr.“ „Das könnte auch an einer Operation liegen.“ „Nicht aber, dass sie sich in einen Schwangerschaftskurs eingeschrieben hat.“ Seevi nahm wieder einen Schluck, nun war er überzeugt und Bäumer fragte ihn: „Was haben wir jetzt eigentlich?“ Seevi warf den leeren Plastikbecher in einen Müllkorb und antwortete: „Ein Motiv und eine Theorie!“



Es klingelte an der Tür und Misel öffnete wie gewohnt. Seevi stand allein davor und bevor er etwas sagen konnte teilte ihm Misel mit: „Strelo, ich meine Prätor Horizonte, ist nicht hier, falls sie ihn sprechen wollen.“ „Das macht nichts, ich wollte eigentlich mit ihnen sprechen.“, erwiderte Seevi darauf, „Darf ich rein kommen?“ „Ja, okay.“ Antwortete Misel leicht verwirrt. Nachdem Seevi eingetreten war, schloss sie die Tür, eigentlich wollte sie ihm einen Platz anbieten, doch der Kommissar begann gleich ein Gespräch, während er die Wohnung begutachtete: „Wir haben in LordxRaven’s Wohnung eine Einladung nach Ankh Morpork gefunden und dort ist er auch ermordet worden. Können sie sich das erklären?“ „Ankh Morpork ist eine beliebte Touristenattraktion.“ „Ja, für Sextouristen, das war auch ein Grund, warum niemand ihn vermisst hat. Jeder dem er von seinem Ausflug dorthin erzählt, ist davon ausgegangen, dass er sich, ich drücke es mal so aus, ordentlich verwöhnen lies.“ „Was wollen sie denn damit sagen?“ fragte Misel langsam die Geduld verlierend. „Ach eigentlich hat das nichts zu sagen, aber wenn ich mir Horizontes Wohnung ansehe, dann bestätigt sich meine Theorie.“ „Wie sie wissen, haben wir beide zusammen gearbeitet zu diesem Zeitpunkt. Es kann also keiner von uns beiden der Mörder sein.“ „Sie geben sich gegenseitig ein Alibi, was ist wenn sie beide es waren, oder einer den anderen schützen will, weil er Gefühle für ihn hegt?“ „Kommen sie endlich zur Sache, Kommissar!“ „Na gut, ich sehe dass sie zwei getrennte Schlafzimmer haben und dies erhärtet meine Theorie. Außerdem sind sie schwanger.“ „Woher wissen sie das?“ „Wir haben unsere Quellen. In welchem Monat sind sie denn?“ „Im zweiten.“ „Mehr brauche ich gar nicht zu wissen, also das denke ich: Sie haben eine Beziehung zu Horizonte aufgebaut, doch hatten sie währenddessen eine kurze aber leidenschaftliche Affäre mit LordxRaven. Von ihm wurden sie schwanger, natürlich bekam das Horizonte mit und so wollten sie sich mit ihm und dem Vater des Kindes verständigen. Also luden sie LordxRaven nach Ankh Morpork ein, Horizonte war bei dem Treffen auch dabei. Sie hofften, dass damit alles vorüber wäre, doch es kam zum Streit, Horizonte wurde wütend und eifersüchtig und schließlich brachte er LordxRaven im Affekt um. Nun decken sie ihn, weil sie nicht beide Väter verlieren wollen!“ „Das ist absoluter Blödsinn.“ „Ach meinen sie?“ Plötzlich klingelte Seevi’s Handy. Er ging ran und sagte: „Ich komme sofort.“ Dann schaltete er sein Handy aus und teilte Misel mit: „Sie haben wohl recht gehabt, meine Theorie wurde gerade widerlegt. Es gab einen zweiten Toten!“


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
 Betreff des Beitrags:
BeitragVerfasst: Fr, 29. Apr 2005 11:20 
Seevi fuhr mit Misel in ein Waldstück im Grenzgebiet zwischen den Hadals und der Light Company. Sie hatte ihn überredet mitfahren zu dürfen, um nahe am Ort des Geschehens zu sein. An einer Kreuzung bog Seevi in einen Waldweg ein, der nach einigen hundert Metern von mehreren Polizeiwagen blockiert wurde. Beide stiegen aus und liefen an den Wagen vorbei bis zu einer Absperrung, da belehrte Seevi Misel: „Sie bleiben hier, verstanden?“ Sie nickte kurz, dann ging Seevi weiter.

Es waren nur wenige Meter bis sich ein vertrautes Bild einstellte, Bäumer und Carter untersuchten das Opfer. Bäumer wand sich Seevi zu: „Sie hatten recht mit der Brieftasche, LordxRaven hatte sie wohl nur vergessen, denn seine hier war in seiner Jackentasche.“ „Dann wissen wir doch auch, um wen es sich hier handelt!“ stellte Seevi fest. „Er hieß Pando.“ „Noch einer aus der Light Company.“ „Und das hier haben wir bei ihm gefunden. Es ist beinahe die gleiche Einladung, die LordxRaven bekommen hatte, nur der Ort und das Datum differieren.“ Seevi nahm die Einladung und las sie sich durch. Dann dachte er kurz nach, sagte sein obligatorisches ‚interessant’ und teilte dann Bäumer seine Vermutung mit: „Der erste Mord geschah am Sonntag um 14:00 Uhr, der zweite am Mittwoch, wieder um 14:00 Uhr, man könnte doch annehmen, dass der nächste Mord morgen, am Samstag um 14:00 Uhr stattfinden soll.“ „Wenn das war ist, sollten wir unbedingt raus finden, ob jemand aus der Light Company oder den Hadals eine Einladung bekommen hat.“ Seevi machte einen Schritt zurück und sagte dann: „Ich bin mit Misel hier, also kümmere ich mich um die Hadals, sie befragen die von der Light Company.“


„Also wenn jemand eine solche Einladung erhalten hat, dann soll er mir das sofort sagen!“ ermahnte Misel die anwesenden Hadalsmitglieder und fuhr dann fort: „Und fragt eure Mitarbeiter, Kollegen und Familien nach solch einer Einladung, es geht hier um Leben und Tod!“ Ein wildes Gemurmel wurde laut und Horny meldete sich ganz vorsichtig. „Ja Horny?“ rief ihn Misel auf, das Gemurmel verstummte und Horny sagte: „Ich hab heute früh so was in meinem Briefkasten gefunden.“

„Wo sollst du hin?“ fragte Misel, nachdem alle bis auf sie, Horny, Horizonte und Seevi, den Raum verlassen hatten. Horny überlegte kurz und antwortete dann: „Elysium, morgen 14:00 Uhr“ „Du gehst da nicht hin, Horny.“ Sagte Misel und wurde dann barsch von Seevi angefahren: „Nein, wenn er da nicht auftaucht, weis der Mörder, dass wir von ihm und seiner Vorgehensweise wissen. Er wird sie dann ändern und dann sterben noch mehr Menschen, wir müssen ihn morgen schnappen. Das ist unsere beste Chance und dafür brauchen wir Horny dort. Er brauch keine Angst zu haben, wir werden ihn schützen.“ Da unterbrach ihn Horizonte: „Nein, das ist Hadals-Land, wir machen das selbst. Ich werde gleich Azmodan und Marco sprechen und die werden einen Hinterhalt für den Mörder vorbereiten, außerdem werden wir uns um Hornys Ausrüstung kümmern, damit er da nicht schutzlos in die Hände eines Mörders läuft.“ „Ich muss widersprechen, dies ist meine Ermittlung.“ Protestierte Seevi verärgert, doch Horizonte sagte nur: „Misel, du bist dran.“ Sie machte einen Schritt auf Seevi zu und sagte: „Paragraph 7, Unterabschnitt 23a, Bei Ermittlungen auf dem Territorium von Außenstehenden der Light Company liegt die Leitung der Ermittlung bei der Örtlichen Souveränität. Uns unserem Fall bedeutet dies, dass sie zu sehen dürfen, aber unsere Leute werden die Arbeit machen!“ Horizonte lächelte und meinte dann zu Seevi: „Ich habe doch gesagt, dass ich Misel diese Verträge überprüfen lasse.“ Seevi war wütend und überrascht, doch er beugte sich: „Na gut, wir sollten aber in die Einzelheiten der Operation mit einbezogen werden."

Wie so oft brannten die beiden Sonnen in der Mittagshitze alles nieder, was sich nicht vor ihren Strahlen schützen konnte. Horny war froh, dass jenes Treffen mit dem Mörder in einem Park stattfand, in dem sich viele Bäume befanden, die einen kühlen Schatten warfen. Ein kleiner Teich tat sein möglichstes die Gäste des Parks weiter zu erfrischen und Horny fragte sich warum an einem solch schönen Ort eine so grausame Handlung, wie ein Mordversuch, stattfinden sollte.

Er ging nervös von einem Baum zu einem anderen, wendete dann und ging wieder zurück zu dem ersten Baum. Dies wiederholte er und meckerte dabei: „Wieso lass ich mich auf so einen Scheiß ständig ein? Hab ich irgendjemanden was getan? Und dann noch dieser tolle Plan, warte bis der Mörder sich zu erkennen gibt, wir nehmen ihn dann fest. Das heißt doch soviel wie, wenn der Kerl dich abgeknallt hat, Horny, dann wissen wir endlich wer der Mörder ist. Ganz toll!“ „Beruhige dich, Horny. Wir haben Scharfschützen, die dich beobachten und auf den ersten feuern, der eine Waffe erhebt um dich zu erschießen.“ Teilte ihm Marco über einen Funkempfänger in Horny’s Ohr mit. „Für euch ist es ja ganz einfach, versteckt, einige hundert Meter entfernt, aber ich bin hier und warte auf mein Ende!“ „Du wirst nicht sterben, zumindest heute nicht, das verspreche ich dir!“ „Ich zähl drauf, verstanden?“

Marco antwortete nicht mehr, da sich ein Mann Horny näherte. Obwohl es ziemlich heiß war, trug dieser einen langen Mantel mit einer Kapuze, die sein Gesicht verbarg. Horny bemerkte ihn und wendete sich ihm zu. Dann fragte er: „Haben sie mich hierher bestellt?“ „Ja, das habe ich, mein alter Freund.“ Antwortete der Mann in einer ruhigen Tonlage.

„Wir haben ihn, das muss er sein!“, rief Master Nitro über die Funkleitung, „Soll ich ihn jetzt ausschalten?“ „Nein, er will offenbar reden, könnte nicht schaden ihm noch etwas zuzuhören. Also erst auf meinen Befehl feuern!“ befahl Marco.

„Wieso sollte ich kommen?“ fragte Horny den Mann, der darauf entgegnete: „Damit du Buße tun kannst.“ „Wofür?“ „Dass du und deine Freunde mein Leben zerstört haben.“ Der Mann zog die Kapuze herunter und Horny erkannte ihn.

„Nichts13, dieses verdammte Schwein hat LordxRaven und Pando umgebracht?“ äußerte Marco verblüfft und Nitro fragte: „Soll ich ihn jetzt neutralisieren?“ „Nein, erst auf meinen Befehl! Horny frag ihn, was er damit genau gemeint hat.“

Horny befolgte die Anweisung: „Wie sollen wir dein Leben zerstört haben, Nichts13.“ Nichts13 brauchte nicht lange zu überlegen und erwiderte: „Bis ich zu euch gestoßen bin, hatte ich die Kerguelen zu wahrer Größe gebracht. Doch dann kamt ihr mit eurem Feldzug gegen GodofWar und Horizonte wollte mich töten. Gott rettete mich zwar, doch hatte ich alles verloren, was ich mir aufgebaut hatte. Nachdem sich Gott mit Sir Martin verbündete, entließ er mich aus unserem Arbeitsverhältnis, ich war nicht mehr seine Hoffnung die Menschen davon abzuhalten die Technologien der Götter an sich zu reißen, nein nun ist es dieser Sir Arsch und ich bin allein. Eigentlich wollte ich das Beste aus der Situation machen, doch selbst meine einstmals getreuen Untertanen wollten mich nicht zurück, sie meinten Seisuke sei einfach der besseren Herrscher. Also versuchte ich neue Untertanen zu finden, erfolglos und dann wurde mir klar warum, sie wollen alle zu euch, in die Light Company und zu den Hadals. So blieb mir nur eine Wahl, wenn ich Untertanen haben wollte, so musste ich erst einmal diese beiden Allianzen des Terrors und der Unterdrückung vernichten! Und jetzt wirst du für deine Taten Buße tun!“ Er zog eine Pistole und richtete sie auf Horny.

„Zugriff!“ schrie Marco und nur eine Sekunde später löste sich erst ein Schuss aus Nichts13’s Pistole, während ihn wenige Millisekunden später ein Energiegeschoss niederstreckte. Nichts13’s Schuss traf Horny in der Brust, er wurde etwa einen Meter nach hinten geschleudert und landete da regungslos auf dem Boden.

Mehrere Mitglieder der PSF-Teams, geführt von Nitro, umstellten Nichts13. Er blickte auf ihn hinunter, während dieser langsam wieder zu sich kam. „Hast Glück, dass wir diese neuen Waffen haben, sonst hätte ich auf deinen Kopf gezielt und ihn hier im Park verteilt.“

Marco und Seevi rannten zu Horny. Dieser lag noch immer am Boden, als Marco ihm eine scheuerte und schrie: „Komm zu dir verdammt!“ „Ja ist ja gut.“ Stöhnte Horny, während er schmerzvoll versuchte seine versengte Sommerjacke auf zu machen. Schließlich gelang es ihm und eine Schutzweste kam zum Vorschein. „Hab ja gesagt, du bist sicher, solange du diese Thermoweste von den Prätorianern und der PSF trägst. Eine normale Kevlarweste hätte zwar das eindringen verhindert, aber die eingelegten Stahlplatten hätten sich durch das Plasma extrem erhitzt und dann wärst du lebendig gebacken worden.“ Sagte Marco und half ihm dann auf, dabei brach ein Teil der Weste ab. „Die halten nur einen Schuss aus?“ fragte Horny und Marco antwortete: „Das war ein Volltreffer, die Platte musste die Energie nicht nur aufnehmen sondern auch so umsetzten, dass sie dir nicht schadet, also ist sie unter anderem oxidiert.“

„Was wird jetzt aus ihm?“ fragte Horny Kommissar Seevi, als man Nichts13 in Handschellen abführte. „Er wird wohl niemals dafür verurteilt, denn ich schätze, dass man ihn sofort in einen geschlossen Psychiatrie einweisen wird. Der Kerl ist doch total durchgeknallt, Gott hat ihn gerettet und will verhindern, dass wir die Technologie der Götter erhalten. So ein Scheiß!“ Marco und Horny blieben zurück, als Seevi in seinen Wagen stieg und Richtung Tharkad mit seinem Gefangenen das Hadals-Land verließ.


Diesen Beitrag melden Mit Zitat antworten
Nach oben
  
Beiträge der letzten Zeit anzeigen:  Sortiere nach  
Forum gesperrt Dieses Thema ist gesperrt. Du kannst keine Beiträge editieren oder weitere Antworten erstellen.  [ 61 Beiträge ]  Gehe zu Seite Vorherige  1, 2, 3, 4  Nächste

Alle Zeiten sind UTC + 1 Stunde [ Sommerzeit ]


Wer ist online?

Mitglieder in diesem Forum: 0 Mitglieder und 1 Gast


Du darfst keine neuen Themen in diesem Forum erstellen.
Du darfst keine Antworten zu Themen in diesem Forum erstellen.
Du darfst deine Beiträge in diesem Forum nicht ändern.
Du darfst deine Beiträge in diesem Forum nicht löschen.
Du darfst keine Dateianhänge in diesem Forum erstellen.

Suche nach:
Gehe zu:  
cron

Powered by phpBB © 2000, 2002, 2005, 2007 phpBB Group
GuildWarsAlliance Style by Daniel St. Jules of Gamexe.net
Guild Wars™ is a trademark of NCsoft Corporation. All rights reserved.
Deutsche Übersetzung durch phpBB.de